Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC12A8-solute carrier family 12 (potassium/chloride transporters), member 8 Gene
PTXBC020506
New product
Data sheet of SLC12A8-solute carrier family 12 (potassium/chloride transporters), member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC12A8-solute carrier family 12 (potassium/chloride transporters), member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020506 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC12A8 |
| Origin species: | Human |
| Product name: | SLC12A8-solute carrier family 12 (potassium/chloride transporters), member 8 Gene |
| Size: | 2ug |
| Accessions: | BC020506 |
| Gene id: | 84561 |
| Gene description: | solute carrier family 12 (potassium/chloride transporters), member 8 |
| Synonyms: | CCC9; solute carrier family 12 member 8; cation-chloride cotransporter 9; solute carrier family 12 (sodium/potassium/chloride transporters), member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgttcctgcagcctgaccccggtgcctgagccggtgctcagggagggcgcagaaggcctccactgctctgagcacctgctcttagagaaagctcccagttacggctctgagggacctgcccaaagagtcttggagggcacgctactggaattcaccaaggacatggatcagctcctccagctaaccaggaagcttgagagtagccagcccaggcaaggagagggtaacaggaccccagaaagtcagaagaggaaaagcaagaaggccaccaagcagaccctacaagatagcttcctcttggacctcaaatcccctccttctttccctgtcgagatctctgacaggttgcccgctgcctcctgggaggggcaggagtcctgctggaacaagcagacttccaagagcgaagggactcagcctgagggaacatatggagagcaacttgttcctgagctgtgcaaccaatcagagtccagtggagaagatttcttcctgaagtccaggctccaagaacaagatgtctggagaagatccacttctttctatacccacatgtgcaacccctgggtctccctgttgggggctgttgggtcccttctcatcatgtttgtgatacagtgggtgtataccctggttaacatgggtgttgctgccatcgtgtatttctacattggccgggccagtccagggcttcaccttggatcagcctccaacttcagctttttccggtggatgaggtctctcttgctcccctcctgcaggagcttgcagtccccccaggagcagatcatcttggcgccgtccctggctaaggttgacatggagatgactcagctcacccaggagaatgcagacttcgccactcgggatcgctaccaccactcctccctcgtgaaccgggagcagctgatgcctcactactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-ray repair complementing defective repair in Chinese hamster cells 4 - melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) - ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) - protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform |