Login to display prices
Login to display prices
CHCHD6-coiled-coil-helix-coiled-coil-helix domain containing 6 Gene View larger

CHCHD6-coiled-coil-helix-coiled-coil-helix domain containing 6 Gene

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD6-coiled-coil-helix-coiled-coil-helix domain containing 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD6-coiled-coil-helix-coiled-coil-helix domain containing 6 Gene

Proteogenix catalog: PTXBC006123
Ncbi symbol: CHCHD6
Product name: CHCHD6-coiled-coil-helix-coiled-coil-helix domain containing 6 Gene
Size: 2ug
Accessions: BC006123
Gene id: 84303
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: CHCM1; Mic25; PPP1R23; MICOS complex subunit MIC25; coiled coil helix cristae morphology 1; coiled-coil-helix cristae morphology protein 1; coiled-coil-helix-coiled-coil-helix domain-containing protein 6, mitochondrial; protein phosphatase 1, regulatory subunit 23; coiled-coil-helix-coiled-coil-helix domain containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggagcacggagagcagcgagggccgcagggtgtccttcggagtggacgaggaggagcgggtccgggtgctgcagggtgtccggctgtctgaaaacgtggtgaaccgcatgaaggagcccagctctccaccccctgctcccacatcttctacctttggccttcaagatggcaacttgagagcccctcacaaagaatccacactgcccaggtcggggagcagtggtggccagcagccctcagggatgaaggagggtgtcaagaggtatgaacaggagcatgctgctatccaggataagctcttccaggtggcaaagagggaaagagaggctgccaccaagcactccaaggcatccctgcccacgggcgaaggcagcatcagccatgaggagcagaagtcagtccggctggccagggagctggagagcagagaggcagagctaagacgccgtgacaccttctacaaggagcagctggagcgtattgagaggaagaatgctgagatgtataaactgtcttcagagcaattccatgaggcagcctcaaagatggagagcacaataaagccccgcagggtggagcccgtctgctcagggttgcaggcccagattctccactgctaccgagatcgcccgcatgaggtgctgctgtgctcggacctggtcaaggcataccagcgctgcgtgagcgccgcccacaagggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: