HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene View larger

HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

PTXBC007963

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007963
Product type: DNA & cDNA
Ncbi symbol: HLA-DPB1
Origin species: Human
Product name: HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene
Size: 2ug
Accessions: BC007963
Gene id: 3115
Gene description: major histocompatibility complex, class II, DP beta 1
Synonyms: HLA-DP; HLA-DP1B; HLA-DPB; HLA class II histocompatibility antigen, DP beta 1 chain; HLA class II histocompatibility antigen, DP(W4) beta chain; HLA-DP histocompatibility type, beta-1 subunit; MHC HLA DPB1; MHC class II HLA-DP-beta-1; MHC class II antigen DPB1; major histocompatibility complex, class II, DP beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggttctgcaggtttctgcggccccccggacagtggctctgacggcgttactgatggtgctgctcacatctgtggtccagggcagggccactccagagaattaccttttccagggacggcaggaatgctacgcgtttaatgggacacagcgcttcctggagagatacatctacaaccgggaggagttcgtgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgctgcggagtactggaacagccagaaggacatcctggaggagaagcgggcagtgccggacaggatgtgcagacacaactacgagctgggcgggcccatgaccctgcagcgccgagtccagcctagggtgaatgtttccccctccaagaaggggcccttgcagcaccacaacctgcttgtctgccacgtgacggatttctacccaggcagcattcaagtccgatggttcctgaatggacaggaggaaacagctggggtcgtgtccaccaacctgatccgtaatggagactggaccttccagatcctggtgatgctggaaatgaccccccagcagggagatgtctacacctgccaagtggagcacaccagcctggatagtcctgtcaccgtggagtggaaggcacagtctgattctgcccggagtaagacattgacgggagctgggggcttcgtgctggggctcatcatctgtggagtgggcatcttcatgcacaggaggagcaagaaagttcaacgaggatctgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DQ beta 1
- major histocompatibility complex, class II, DR beta 1
- major histocompatibility complex, class II, DR beta 4
- polymerase (RNA) II (DNA directed) polypeptide C, 33kDa

Buy HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene now

Add to cart