Login to display prices
Login to display prices
HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene View larger

HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene

PTXBC007920

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene

Proteogenix catalog: PTXBC007920
Ncbi symbol: HLA-DRB1
Product name: HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene
Size: 2ug
Accessions: BC007920
Gene id: 3123
Gene description: major histocompatibility complex, class II, DR beta 1
Synonyms: DRB1; HLA-DR1B; HLA-DRB; SS1; major histocompatibility complex, class II, DR beta 1; HLA class II histocompatibility antigen, DR-1 beta chain; MHC class II HLA-DR beta 1 chain; human leucocyte antigen DRB1; lymphocyte antigen DRB1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgtctgaggctccctggaggctcctgcatggcagttctgacagtgacactgatggtgctgagctccccactggctttggctggggacaccagaccacgtttcttggagtactctacgtctgagtgtcatttcttcaatgggacggagcgggtgcggttcctggacagatacttccataaccaggaggagaacgtgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgatgccgagtactggaacagccagaaggacatcctggaagacgagcgggccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagtccatcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccacaacctcctggtctgttctgtgagtggtttctatccaggcagcattgaagtcaggtggttccggaatggccaggaagagaagactggggtggtgtccacaggcctgatccacaatggagactggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacctgccaagtggagcacccaagcgtgacaagccctctcacagtggaatggagagcacggtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggctgttcatctacttcaggaatcagaaaggacactctggacttcagccaagaggattcctgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: