Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene
PTXBC007920
New product
Data sheet of HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007920 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DRB1 |
| Origin species: | Human |
| Product name: | HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene |
| Size: | 2ug |
| Accessions: | BC007920 |
| Gene id: | 3123 |
| Gene description: | major histocompatibility complex, class II, DR beta 1 |
| Synonyms: | DRB1; HLA-DR1B; HLA-DRB; SS1; major histocompatibility complex, class II, DR beta 1; HLA class II histocompatibility antigen, DR-1 beta chain; MHC class II HLA-DR beta 1 chain; human leucocyte antigen DRB1; lymphocyte antigen DRB1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgtgtctgaggctccctggaggctcctgcatggcagttctgacagtgacactgatggtgctgagctccccactggctttggctggggacaccagaccacgtttcttggagtactctacgtctgagtgtcatttcttcaatgggacggagcgggtgcggttcctggacagatacttccataaccaggaggagaacgtgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgatgccgagtactggaacagccagaaggacatcctggaagacgagcgggccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagtccatcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccacaacctcctggtctgttctgtgagtggtttctatccaggcagcattgaagtcaggtggttccggaatggccaggaagagaagactggggtggtgtccacaggcctgatccacaatggagactggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacctgccaagtggagcacccaagcgtgacaagccctctcacagtggaatggagagcacggtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggctgttcatctacttcaggaatcagaaaggacactctggacttcagccaagaggattcctgagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DR beta 4 - polymerase (RNA) II (DNA directed) polypeptide C, 33kDa - cleft lip and palate associated transmembrane protein 1 - lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) |