HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene View larger

HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007920
Product type: DNA & cDNA
Ncbi symbol: HLA-DRB1
Origin species: Human
Product name: HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene
Size: 2ug
Accessions: BC007920
Gene id: 3123
Gene description: major histocompatibility complex, class II, DR beta 1
Synonyms: DRB1; HLA-DR1B; HLA-DRB; SS1; major histocompatibility complex, class II, DR beta 1; HLA class II histocompatibility antigen, DR-1 beta chain; MHC class II HLA-DR beta 1 chain; human leucocyte antigen DRB1; lymphocyte antigen DRB1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgtctgaggctccctggaggctcctgcatggcagttctgacagtgacactgatggtgctgagctccccactggctttggctggggacaccagaccacgtttcttggagtactctacgtctgagtgtcatttcttcaatgggacggagcgggtgcggttcctggacagatacttccataaccaggaggagaacgtgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgatgccgagtactggaacagccagaaggacatcctggaagacgagcgggccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagtccatcctaaggtgactgtgtatccttcaaagacccagcccctgcagcaccacaacctcctggtctgttctgtgagtggtttctatccaggcagcattgaagtcaggtggttccggaatggccaggaagagaagactggggtggtgtccacaggcctgatccacaatggagactggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaggtttacacctgccaagtggagcacccaagcgtgacaagccctctcacagtggaatggagagcacggtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggctgttcatctacttcaggaatcagaaaggacactctggacttcagccaagaggattcctgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DR beta 4
- polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
- cleft lip and palate associated transmembrane protein 1
- lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)

Buy HLA-DRB1-major histocompatibility complex, class II, DR beta 1 Gene now

Add to cart