Login to display prices
Login to display prices
POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene View larger

POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene

PTXBC000409

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene

Proteogenix catalog: PTXBC000409
Ncbi symbol: POLR2C
Product name: POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene
Size: 2ug
Accessions: BC000409
Gene id: 5432
Gene description: polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
Synonyms: RPB3; RPB31; hRPB33; hsRPB3; DNA-directed RNA polymerase II subunit RPB3; DNA-directed RNA polymerase II 33 kDa polypeptide; DNA-directed RNA polymerase II subunit C; RNA polymerase II subunit 3; RNA polymerase II subunit B3; RPB33; polymerase (RNA) II (DNA directed) polypeptide C, 33kDa; polymerase (RNA) II subunit C; RNA polymerase II subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtacgccaaccagcctaccgtgcggatcacggagctcactgacgagaatgtcaagttcatcatcgagaacaccgacctggcggtggccaattcgattcggagggtcttcatcgctgaggttcccataatagccattgactgggttcagattgatgccaattcctcagtccttcatgatgaattcattgctcacaggcttggattaattcccctcattagtgatgacattgtggacaagctgcagtactctcgggactgcacatgtgaggagttctgccccgagtgctcggtggagttcaccctcgatgtgcggtgcaatgaagaccagacgcgacatgtcacgtctcgagacctcatctccaacagcccccgggtcattccggtgacatcccggaaccgagataatgaccccaatgactacgtggagcaggatgacatcctcatcgtcaagttgagaaagggccaggagctgagacttcgagcctatgccaaaaagggctttggcaaggagcatgccaagtggaaccctactgcaggggtggcttttgaatacgatccagacaatgccctgaggcacacagtgtaccccaagcccgaggaatggccaaagagtgagtactcggagctggatgaggatgagtcgcaggctccctatgaccccaacggcaagccagaaaggttttactacaatgtggagtcctgtggctctctgcgtcctgaaaccattgtcctgtcagccctctcaggattgaagaagaaactgagtgatttacaaactcaattaagccacgagatccagagtgatgtgctaaccataaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: