POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene View larger

POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000409
Product type: DNA & cDNA
Ncbi symbol: POLR2C
Origin species: Human
Product name: POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene
Size: 2ug
Accessions: BC000409
Gene id: 5432
Gene description: polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
Synonyms: RPB3; RPB31; hRPB33; hsRPB3; DNA-directed RNA polymerase II subunit RPB3; DNA-directed RNA polymerase II 33 kDa polypeptide; DNA-directed RNA polymerase II subunit C; RNA polymerase II subunit 3; RNA polymerase II subunit B3; RPB33; polymerase (RNA) II (DNA directed) polypeptide C, 33kDa; polymerase (RNA) II subunit C; RNA polymerase II subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtacgccaaccagcctaccgtgcggatcacggagctcactgacgagaatgtcaagttcatcatcgagaacaccgacctggcggtggccaattcgattcggagggtcttcatcgctgaggttcccataatagccattgactgggttcagattgatgccaattcctcagtccttcatgatgaattcattgctcacaggcttggattaattcccctcattagtgatgacattgtggacaagctgcagtactctcgggactgcacatgtgaggagttctgccccgagtgctcggtggagttcaccctcgatgtgcggtgcaatgaagaccagacgcgacatgtcacgtctcgagacctcatctccaacagcccccgggtcattccggtgacatcccggaaccgagataatgaccccaatgactacgtggagcaggatgacatcctcatcgtcaagttgagaaagggccaggagctgagacttcgagcctatgccaaaaagggctttggcaaggagcatgccaagtggaaccctactgcaggggtggcttttgaatacgatccagacaatgccctgaggcacacagtgtaccccaagcccgaggaatggccaaagagtgagtactcggagctggatgaggatgagtcgcaggctccctatgaccccaacggcaagccagaaaggttttactacaatgtggagtcctgtggctctctgcgtcctgaaaccattgtcctgtcagccctctcaggattgaagaagaaactgagtgatttacaaactcaattaagccacgagatccagagtgatgtgctaaccataaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cleft lip and palate associated transmembrane protein 1
- lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
- coiled-coil-helix-coiled-coil-helix domain containing 7
- MRS2 magnesium homeostasis factor homolog (S. cerevisiae)

Buy POLR2C-polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Gene now

Add to cart