MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene View larger

MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene

PTXBC001028

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001028
Product type: DNA & cDNA
Ncbi symbol: MRS2
Origin species: Human
Product name: MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001028
Gene id: 57380
Gene description: MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
Synonyms: MRS2, magnesium transporter; MRS2-like, magnesium homeostasis factor; MRS2-like protein; magnesium transporter MRS2 homolog, mitochondrial; HPT; MRS2L
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatgcctgcgcagtttaccctgcctcctgccccgcgcgatgagacttccccggcggacgctgtgtgccctggccttggacgtgacctctgtgggtcctcccgttgctgcctgcggccgccgagccaacctgattggaaggagccgagcggcgcagctttgcgggcccgaccggctccgcgtggcaggtgaagtgcaccggtttagaacctctgacgtctctcaagccactttagccagtgtagccccagtatttactgtgacaaaatttgacaaacagggaaacgttacttcttttgtatttgaaagctgtgataactccagagtgtcttctgatattagattatcgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin polymerization-promoting protein family member 3
- ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
- ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
- N-6 adenine-specific DNA methyltransferase 2 (putative)

Buy MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene now

Add to cart