TPPP3-tubulin polymerization-promoting protein family member 3 Gene View larger

TPPP3-tubulin polymerization-promoting protein family member 3 Gene

PTXBC000691

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPPP3-tubulin polymerization-promoting protein family member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPPP3-tubulin polymerization-promoting protein family member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000691
Product type: DNA & cDNA
Ncbi symbol: TPPP3
Origin species: Human
Product name: TPPP3-tubulin polymerization-promoting protein family member 3 Gene
Size: 2ug
Accessions: BC000691
Gene id: 51673
Gene description: tubulin polymerization-promoting protein family member 3
Synonyms: CGI-38; TPPP/p20; p20; p25gamma; tubulin polymerization-promoting protein family member 3; brain specific protein; tubulin polymerization promoting protein family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcgagcacagacatggctgggctggaggagagcttccgcaagtttgccatccatggtgaccccaaggccagtgggcaagagatgaatggcaagaactgggccaagctgtgcaaggactgcaaggtggctgacggaaagtccgtgacagggaccgatgtggacatcgtcttctccaaagtcaaggggaagtctgctcgggtcatcaactatgaggagttcaagaaggccctggaagagctggcgaccaagagattcaaggggaagagcaaggaggaggccttcgatgccatctgccagctggtggcaggcaaagagccagccaatgtgggcgtcactaaagcaaaaacagggggtgctgtagaccggctgacggacaccagcagatacacgggctcccacaaggagcgcttcgatgagagcggcaagggcaagggcattgcgggacggcaggacatcctggacgacagtggctacgtgagcgcctacaagaatgcaggcacctacgatgccaaggtgaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
- ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
- N-6 adenine-specific DNA methyltransferase 2 (putative)
- cytochrome P450, family 19, subfamily A, polypeptide 1

Buy TPPP3-tubulin polymerization-promoting protein family member 3 Gene now

Add to cart