Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TPPP3-tubulin polymerization-promoting protein family member 3 Gene
PTXBC000691
New product
Data sheet of TPPP3-tubulin polymerization-promoting protein family member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPPP3-tubulin polymerization-promoting protein family member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000691 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPPP3 |
| Origin species: | Human |
| Product name: | TPPP3-tubulin polymerization-promoting protein family member 3 Gene |
| Size: | 2ug |
| Accessions: | BC000691 |
| Gene id: | 51673 |
| Gene description: | tubulin polymerization-promoting protein family member 3 |
| Synonyms: | CGI-38; TPPP/p20; p20; p25gamma; tubulin polymerization-promoting protein family member 3; brain specific protein; tubulin polymerization promoting protein family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcgagcacagacatggctgggctggaggagagcttccgcaagtttgccatccatggtgaccccaaggccagtgggcaagagatgaatggcaagaactgggccaagctgtgcaaggactgcaaggtggctgacggaaagtccgtgacagggaccgatgtggacatcgtcttctccaaagtcaaggggaagtctgctcgggtcatcaactatgaggagttcaagaaggccctggaagagctggcgaccaagagattcaaggggaagagcaaggaggaggccttcgatgccatctgccagctggtggcaggcaaagagccagccaatgtgggcgtcactaaagcaaaaacagggggtgctgtagaccggctgacggacaccagcagatacacgggctcccacaaggagcgcttcgatgagagcggcaagggcaagggcattgcgggacggcaggacatcctggacgacagtggctacgtgagcgcctacaagaatgcaggcacctacgatgccaaggtgaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ASF1 anti-silencing function 1 homolog B (S. cerevisiae) - ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b - N-6 adenine-specific DNA methyltransferase 2 (putative) - cytochrome P450, family 19, subfamily A, polypeptide 1 |