Login to display prices
Login to display prices
ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene View larger

ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene

PTXBC000423

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene

Proteogenix catalog: PTXBC000423
Ncbi symbol: ATP6V0B
Product name: ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene
Size: 2ug
Accessions: BC000423
Gene id: 533
Gene description: ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
Synonyms: ATP6F; HATPL; VMA16; V-type proton ATPase 21 kDa proteolipid subunit; ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b; ATPase, H+ transporting, lysosomal, 21-KD, V0 subunit C-prime, prime; ATPase, H+ transporting, lysosomal, subunit F; H(+)-transporting two-sector ATPase, subunit F; V-ATPase 21 kDa proteolipid subunit; V-ATPase subunit c''; vacuolar ATP synthase 21 kDa proteolipid subunit; vacuolar proton pump 21 kDa proteolipid subunit; ATPase H+ transporting V0 subunit b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggggctagcactgctctactccggggtcttcgtggccttctgggcctgcgcgctggccgtgggagtctgctacaccatttttgatttgggcttccgctttgatgtggcatggttcctgacggagacttcgcccttcatgtggtccaacctgggcattggcctagctatctccctgtctgtggttggggcagcctggggcatctatattaccggctcctccatcattggtggaggagtgaaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggctgtggccatctacggcatcatcatggcaattgtcattagcaacatggctgagcctttcagtgccacagaccccaaggccatcggccatcggaactaccatgcaggctactccatgtttggggctggcctcaccgtaggcctgtctaacctcttctgtggagtctgcgtgggcatcgtgggcagtggggctgccctggccgatgctcagaaccccagcctctttgtaaagattctcatcgtggagatctttggcagcgccattggcctctttggggtcatcgtcgcaattcttcagacctccagagtgaagatgggtgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: