Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene
PTXBC000423
New product
Data sheet of ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000423 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V0B |
| Origin species: | Human |
| Product name: | ATP6V0B-ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b Gene |
| Size: | 2ug |
| Accessions: | BC000423 |
| Gene id: | 533 |
| Gene description: | ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b |
| Synonyms: | ATP6F; HATPL; VMA16; V-type proton ATPase 21 kDa proteolipid subunit; ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b; ATPase, H+ transporting, lysosomal, 21-KD, V0 subunit C-prime, prime; ATPase, H+ transporting, lysosomal, subunit F; H(+)-transporting two-sector ATPase, subunit F; V-ATPase 21 kDa proteolipid subunit; V-ATPase subunit c''; vacuolar ATP synthase 21 kDa proteolipid subunit; vacuolar proton pump 21 kDa proteolipid subunit; ATPase H+ transporting V0 subunit b |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggggctagcactgctctactccggggtcttcgtggccttctgggcctgcgcgctggccgtgggagtctgctacaccatttttgatttgggcttccgctttgatgtggcatggttcctgacggagacttcgcccttcatgtggtccaacctgggcattggcctagctatctccctgtctgtggttggggcagcctggggcatctatattaccggctcctccatcattggtggaggagtgaaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggctgtggccatctacggcatcatcatggcaattgtcattagcaacatggctgagcctttcagtgccacagaccccaaggccatcggccatcggaactaccatgcaggctactccatgtttggggctggcctcaccgtaggcctgtctaacctcttctgtggagtctgcgtgggcatcgtgggcagtggggctgccctggccgatgctcagaaccccagcctctttgtaaagattctcatcgtggagatctttggcagcgccattggcctctttggggtcatcgtcgcaattcttcagacctccagagtgaagatgggtgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-6 adenine-specific DNA methyltransferase 2 (putative) - cytochrome P450, family 19, subfamily A, polypeptide 1 - ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D - major histocompatibility complex, class II, DR beta 1 |