Login to display prices
Login to display prices
CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene View larger

CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035714
Product type: DNA & cDNA
Ncbi symbol: CYP19A1
Origin species: Human
Product name: CYP19A1-cytochrome P450, family 19, subfamily A, polypeptide 1 Gene
Size: 2ug
Accessions: BC035714
Gene id: 1588
Gene description: cytochrome P450, family 19, subfamily A, polypeptide 1
Synonyms: ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM; cytochrome P-450AROM; cytochrome P450 19A1; cytochrome P450, family 19, subfamily A, polypeptide 1; cytochrome P450, subfamily XIX (aromatization of androgens); estrogen synthase; estrogen synthetase; flavoprotein-linked monooxygenase; microsomal monooxygenase; cytochrome P450 family 19 subfamily A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttttggaaatgctgaacccgatacattataacatcaccagcatcgtgcctgaagccatgcctgctgccaccatgccagtcctgctcctcactggcctttttctcttggtgtggaattatgagggcacatcctcaataccaggtcctggctactgcatgggaattggacccctcatctcccacggcagattcctgtggatggggatcggcagtgcctgcaactactacaaccgggtatatggagaattcatgcgagtctggatctctggagaggaaacactcattatcagcaagtcctcaagtatgttccacataatgaagcacaatcattacagctctcgattcggcagcaaacttgggctgcagtgcatcggtatgcatgagaaaggcatcatatttaacaacaatccagagctctggaaaacaactcgacccttctttatgaaagctctgtcaggccccggccttgttcgtatggtcacagtctgtgctgaatccctcaaaacacatctggacaggttggaggaggtgaccaatgaatcgggctatgtggacgtgttgacccttctgcgtcgtgtcatgctggacacctctaacacgctcttcttgaggatccctttggacggtactgaaattttcactctcacatcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
- major histocompatibility complex, class II, DR beta 1
- major histocompatibility complex, class II, DR beta 3
- protein phosphatase 1, catalytic subunit, gamma isoform