Login to display prices
Login to display prices
PPP1CC-protein phosphatase 1, catalytic subunit, gamma isoform Gene View larger

PPP1CC-protein phosphatase 1, catalytic subunit, gamma isoform Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1CC-protein phosphatase 1, catalytic subunit, gamma isoform Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1CC-protein phosphatase 1, catalytic subunit, gamma isoform Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014073
Product type: DNA & cDNA
Ncbi symbol: PPP1CC
Origin species: Human
Product name: PPP1CC-protein phosphatase 1, catalytic subunit, gamma isoform Gene
Size: 2ug
Accessions: BC014073
Gene id: 5501
Gene description: protein phosphatase 1, catalytic subunit, gamma isoform
Synonyms: PP-1G; PP1C; PPP1G; serine/threonine-protein phosphatase PP1-gamma catalytic subunit; protein phosphatase 1, catalytic subunit, gamma isoform; protein phosphatase 1, catalytic subunit, gamma isozyme; protein phosphatase 1C catalytic subunit; serine/threonine phosphatase 1 gamma; protein phosphatase 1 catalytic subunit gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatttagataaactcaacatcgacagcattatccaacggctgctggaagtgagagggtccaagcctggtaagaatgtccagcttcaggagaatgaaatcagaggactgtgcttaaagtctcgtgaaatctttctcagtcagcctatcctactagaacttgaagcaccactcaaaatatgtggtgacatccatggacaatactatgatttgctgcgactttttgagtacggtggtttcccaccagaaagcaactacctgtttcttggggactatgtggacaggggaaagcagtcattggagacgatctgcctcttactggcctacaaaataaaatatcctgagaatttttttcttctcagagggaaccatgaatgtgccagcatcaacagaatttatggattttatgatgaatgtaaaagaagatacaacattaaactatggaaaactttcacagactgttttaactgtttaccgatagcagccatcgtggatgagaagatattctgctgtcatggaggtttatcaccagatcttcaatctatggagcagattcggcgaattatgcgaccaactgatgtaccagatcaaggtcttctttgtgatcttttgtggtctgaccccgataaagatgtcttaggctggggtgaaaatgacagaggagtgtccttcacatttggtgcagaagtggttgcaaaatttctccataagcatgatttggatcttatatgtagagcccatcaggtggttgaagatggatatgaattttttgcaaagaggcagttggtcactctgttttctgcgcccaattattgcggagagtttgacaatgcaggtgccatgatgagtgtggatgaaacactaatgtgttcttttcagattttaaagcctgcagagaaaaagaagccaaatgccacgagacctgtaacgcctccaaggggtatgatcacaaagcaagcaaagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor, family C, group 5, member A
- GA binding protein transcription factor, beta subunit 1
- transforming growth factor beta 1 induced transcript 1
- cytochrome P450, family 20, subfamily A, polypeptide 1