Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene
PTXBC001507
New product
Data sheet of TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001507 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TGFB1I1 |
| Origin species: | Human |
| Product name: | TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene |
| Size: | 2ug |
| Accessions: | BC001507 |
| Gene id: | 7041 |
| Gene description: | transforming growth factor beta 1 induced transcript 1 |
| Synonyms: | ARA55; HIC5; TSC-5; transforming growth factor beta-1-induced transcript 1 protein; androgen receptor coactivator 55 kDa protein; androgen receptor coactivator ARA55; androgen receptor-associated protein of 55 kDa; hydrogen peroxide-inducible clone 5 protein; hydrogen peroxide-inducible clone-5; transforming growth factor beta 1 induced transcript 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaaggtcaggggctcccaaagagcgccctgcggagcctctcacccctcccccatcctatggccaccagccacagacagggtctggggagtcttcaggagcctcgggggacaaggaccacctgtacagcacggtatgcaagcctcggtccccaaagcctgcagccccggcggcccctccattctcctcttccagcggtgtcttgggtaccgggctctgtgagctagatcggttgcttcaggaacttaatgccactcagttcaacatcacagatgaaatcatgtctcagttcccatctagcaaggtggcttcaggagagcagaaggaggaccagtctgaagataagaaaagacccagcctcccttccagcccgtctcctggcctcccaaaggcttctgccacctcagccactctggagctggatagactgatggcctcactctctgacttccgcgttcaaaaccatcttccagcctctgggccaactcagccaccggtggtgagctccacaaatgagggctccccatccccaccagagccgactggcaagggcagcctagacaccatgctggggctgctgcagtccgacctcagccgccggggtgttcccacccaggccaaaggcctctgtggctcctgcaataaacctattgctgggcaagtggtgacggctctgggccgcgcctggcaccccgagcacttcgtttgcggaggctgttccaccgccctgggaggcagcagcttcttcgagaaggatggagcccccttctgccccgagtgctactttgagcgcttctcgccaagatgtggcttctgcaaccagcccatccgacacaagatggtgaccgccttgggcactcactggcacccagagcatttctgctgcgtcagttgcggggagcccttcggagatgagggtttccacgagcgcgagggccgcccctactgccgccgggacttcctgcagctgttcgccccgcgctgccagggctgccagggccccatcctggataactacatctcggcgctcagcgcgctctggcacccggactgtttcgtctgcagggaatgcttcgcgcccttctcgggaggcagctttttcgagcacgagggccgcccgttgtgcgagaaccacttccacgcacgacgcggctcgctgtgcgccacgtgtggcctccctgtgaccggccgctgcgtgtcggccctgggtcgccgcttccacccggaccacttcacatgcaccttctgcctgcgcccgctcaccaaggggtccttccaggagcgcgccggcaagccctactgccagccctgcttcctgaagctcttcggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 20, subfamily A, polypeptide 1 - cytochrome P450, family 39, subfamily A, polypeptide 1 - TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae) - guanine nucleotide binding protein (G protein), gamma 10 |