TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene View larger

TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001507
Product type: DNA & cDNA
Ncbi symbol: TGFB1I1
Origin species: Human
Product name: TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene
Size: 2ug
Accessions: BC001507
Gene id: 7041
Gene description: transforming growth factor beta 1 induced transcript 1
Synonyms: ARA55; HIC5; TSC-5; transforming growth factor beta-1-induced transcript 1 protein; androgen receptor coactivator 55 kDa protein; androgen receptor coactivator ARA55; androgen receptor-associated protein of 55 kDa; hydrogen peroxide-inducible clone 5 protein; hydrogen peroxide-inducible clone-5; transforming growth factor beta 1 induced transcript 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaggtcaggggctcccaaagagcgccctgcggagcctctcacccctcccccatcctatggccaccagccacagacagggtctggggagtcttcaggagcctcgggggacaaggaccacctgtacagcacggtatgcaagcctcggtccccaaagcctgcagccccggcggcccctccattctcctcttccagcggtgtcttgggtaccgggctctgtgagctagatcggttgcttcaggaacttaatgccactcagttcaacatcacagatgaaatcatgtctcagttcccatctagcaaggtggcttcaggagagcagaaggaggaccagtctgaagataagaaaagacccagcctcccttccagcccgtctcctggcctcccaaaggcttctgccacctcagccactctggagctggatagactgatggcctcactctctgacttccgcgttcaaaaccatcttccagcctctgggccaactcagccaccggtggtgagctccacaaatgagggctccccatccccaccagagccgactggcaagggcagcctagacaccatgctggggctgctgcagtccgacctcagccgccggggtgttcccacccaggccaaaggcctctgtggctcctgcaataaacctattgctgggcaagtggtgacggctctgggccgcgcctggcaccccgagcacttcgtttgcggaggctgttccaccgccctgggaggcagcagcttcttcgagaaggatggagcccccttctgccccgagtgctactttgagcgcttctcgccaagatgtggcttctgcaaccagcccatccgacacaagatggtgaccgccttgggcactcactggcacccagagcatttctgctgcgtcagttgcggggagcccttcggagatgagggtttccacgagcgcgagggccgcccctactgccgccgggacttcctgcagctgttcgccccgcgctgccagggctgccagggccccatcctggataactacatctcggcgctcagcgcgctctggcacccggactgtttcgtctgcagggaatgcttcgcgcccttctcgggaggcagctttttcgagcacgagggccgcccgttgtgcgagaaccacttccacgcacgacgcggctcgctgtgcgccacgtgtggcctccctgtgaccggccgctgcgtgtcggccctgggtcgccgcttccacccggaccacttcacatgcaccttctgcctgcgcccgctcaccaaggggtccttccaggagcgcgccggcaagccctactgccagccctgcttcctgaagctcttcggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome P450, family 20, subfamily A, polypeptide 1
- cytochrome P450, family 39, subfamily A, polypeptide 1
- TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae)
- guanine nucleotide binding protein (G protein), gamma 10

Buy TGFB1I1-transforming growth factor beta 1 induced transcript 1 Gene now

Add to cart