GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene View larger

GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene

PTXBC010384

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010384
Product type: DNA & cDNA
Ncbi symbol: GNG10
Origin species: Human
Product name: GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene
Size: 2ug
Accessions: BC010384
Gene id: 2790
Gene description: guanine nucleotide binding protein (G protein), gamma 10
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-10; guanine nucleotide binding protein (G protein), gamma 10; guanine nucleotide binding protein 10; G protein subunit gamma 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctccggggctagcgcgagcgccctgcagcgcttggtagagcagctcaagttggaggctggcgtggagaggatcaaggtctctcaggcagctgcagagcttcaacagtactgtatgcagaatgcctgcaaggatgccctgctggtgggtgttccagctggaagtaaccccttccgggagcctagatcctgtgctttactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil-helix-coiled-coil-helix domain containing 5
- coiled-coil-helix-coiled-coil-helix domain containing 1
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
- ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c

Buy GNG10-guanine nucleotide binding protein (G protein), gamma 10 Gene now

Add to cart