CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene View larger

CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015387
Product type: DNA & cDNA
Ncbi symbol: CHCHD1
Origin species: Human
Product name: CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene
Size: 2ug
Accessions: BC015387
Gene id: 118487
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 1
Synonyms: C10orf34; MRP-S37; coiled-coil-helix-coiled-coil-helix domain-containing protein 1; 28S ribosomal protein S37, mitochondrial; nuclear protein C2360; coiled-coil-helix-coiled-coil-helix domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacacccagcctgcggggtcgtctggcgcggtttgggaacccgcggaagcctgtgctgaagcccaataaacctctcattctagctaaccgcgtcggggagcggcgccgggagaagggcgaggcgacttgcatcacggagatgtcggtgatgatggcttgctggaagcagaatgaattccgcgacgatgcgtgcagaaaagagatccagggcttcctcgattgtgccgcgagggctcaggaagcccgaaagatgagatcaatacaggaaaccctgggagagtctgggagtttacttccaaataaattgaataagttgttacagaggtttcctaacaaaccttacctcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
- ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
- ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
- transmembrane emp24-like trafficking protein 10 (yeast)

Buy CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene now

Add to cart