Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene
PTXBC015387
New product
Data sheet of CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHCHD1 |
| Origin species: | Human |
| Product name: | CHCHD1-coiled-coil-helix-coiled-coil-helix domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC015387 |
| Gene id: | 118487 |
| Gene description: | coiled-coil-helix-coiled-coil-helix domain containing 1 |
| Synonyms: | C10orf34; MRP-S37; coiled-coil-helix-coiled-coil-helix domain-containing protein 1; 28S ribosomal protein S37, mitochondrial; nuclear protein C2360; coiled-coil-helix-coiled-coil-helix domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgacacccagcctgcggggtcgtctggcgcggtttgggaacccgcggaagcctgtgctgaagcccaataaacctctcattctagctaaccgcgtcggggagcggcgccgggagaagggcgaggcgacttgcatcacggagatgtcggtgatgatggcttgctggaagcagaatgaattccgcgacgatgcgtgcagaaaagagatccagggcttcctcgattgtgccgcgagggctcaggaagcccgaaagatgagatcaatacaggaaaccctgggagagtctgggagtttacttccaaataaattgaataagttgttacagaggtttcctaacaaaccttacctcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - transmembrane emp24-like trafficking protein 10 (yeast) |