TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene View larger

TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001496
Product type: DNA & cDNA
Ncbi symbol: TMED10
Origin species: Human
Product name: TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene
Size: 2ug
Accessions: BC001496
Gene id: 10972
Gene description: transmembrane emp24-like trafficking protein 10 (yeast)
Synonyms: P24(DELTA); S31I125; S31III125; TMP21; Tmp-21-I; p23; p24d1; transmembrane emp24 domain-containing protein 10; 21 kDa transmembrane trafficking protein; p24 family protein delta-1; p24delta; p24delta1; testicular tissue protein Li 206; transmembrane emp24-like trafficking protein 10; transmembrane protein Tmp21; transmembrane p24 trafficking protein 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggtttgtctggcccaccagcccggcgcggcccttttccgttagcgttgctgcttttgttcctgctcggccccagattggtccttgccatctccttccatctgcccattaactctcgcaagtgcctccgtgaggagattcacaaggacctgctagtgactggcgcgtacgagatctccgaccagtctgggggcgctggcggcctgcgcagccacctcaagatcacagattctgctggccatattctctactccaaagaggatgcaaccaaggggaaatttgcctttaccactgaagattatgacatgtttgaagtgtgttttgagagcaagggaacagggcggatacctgaccaactcgtgatcctagacatgaagcatggagtggaggcgaaaaattacgaagagattgcaaaagttgagaagctcaaaccattagaggtagagctgcgacgcctagaagacctttcagaatctattgttaatgattttgcctacatgaagaagagagaagaggagatgcgtgataccaacgagtcaacaaacactcgggtcctatacttcagcatcttttcaatgttctgtctcattggactagctacctggcaggtcttctacctgcgacgcttcttcaaggccaagaaattgattgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil-helix-coiled-coil-helix domain containing 3
- major histocompatibility complex, class II, DQ beta 2
- haloacid dehalogenase-like hydrolase domain containing 3
- cytidine monophosphate N-acetylneuraminic acid synthetase

Buy TMED10-transmembrane emp24-like trafficking protein 10 (yeast) Gene now

Add to cart