Login to display prices
Login to display prices
CHCHD3-coiled-coil-helix-coiled-coil-helix domain containing 3 Gene View larger

CHCHD3-coiled-coil-helix-coiled-coil-helix domain containing 3 Gene

PTXBC011596

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD3-coiled-coil-helix-coiled-coil-helix domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD3-coiled-coil-helix-coiled-coil-helix domain containing 3 Gene

Proteogenix catalog: PTXBC011596
Ncbi symbol: CHCHD3
Product name: CHCHD3-coiled-coil-helix-coiled-coil-helix domain containing 3 Gene
Size: 2ug
Accessions: BC011596
Gene id: 54927
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 3
Synonyms: MINOS3; Mic19; PPP1R22; MICOS complex subunit MIC19; coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrial; mitochondrial inner membrane organizing system 3; protein phosphatase 1, regulatory subunit 22; coiled-coil-helix-coiled-coil-helix domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgggaccaccagcacccgccgggtcaccttcgaggcggacgagaatgagaacatcaccgtggtgaagggcatccggctttcggaaaatgtgattgatcgaatgaaggaatcctctccatctggttcgaagtctcagcggtattctggtgcttatggtgcctcagtttctgatgaagaattgaaaagaagagtagctgaggagctggcattggagcaagccaagaaagaatccgaagatcagaaacgactaaagcaagccaaagagctggaccgagagagggctgctgccaatgagcagttaaccagagccatccttcgggagaggatatgtagcgaggaggaacgcgctaaggcaaagcacctggctaggcagctggaagagaaagaccgagtgctaaagaagcaggatgcattctacaaagaacagctggctagactggaggagaggagctcagagttctacagagtcaccactgaacaatatcagaaagctgctgaagaggtggaagcaaagttcaagcgatatgagtctcatccagtctgtgctgatctgcaggccaaaattcttcagtgttaccgtgagaacacccaccagaccctcaaatgctccgctctggccacccagtatatgcactgtgtcaatcatgccaaacagagcatgcttgagaagggaggataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: