Login to display prices
Login to display prices
HDHD3-haloacid dehalogenase-like hydrolase domain containing 3 Gene View larger

HDHD3-haloacid dehalogenase-like hydrolase domain containing 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDHD3-haloacid dehalogenase-like hydrolase domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HDHD3-haloacid dehalogenase-like hydrolase domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005048
Product type: DNA & cDNA
Ncbi symbol: HDHD3
Origin species: Human
Product name: HDHD3-haloacid dehalogenase-like hydrolase domain containing 3 Gene
Size: 2ug
Accessions: BC005048
Gene id: 81932
Gene description: haloacid dehalogenase-like hydrolase domain containing 3
Synonyms: 2810435D12Rik; C9orf158; haloacid dehalogenase-like hydrolase domain-containing protein 3; haloacid dehalogenase like hydrolase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacaccggctgcagatacgactgctgacgtgggatgtgaaggacacgctgctcaggctccgccaccccttaggggaggcctatgccaccaaggcccgggcccatgggctggaggtggagccctcagccctggaacaaggcttcaggcaggcatacagggctcagagccacagcttccccaactacggcctgagccacggcctaacctcccgccagtggtggctggatgtggtcctgcagaccttccacctggcgggtgtccaggatgctcaggctgtagcccccatcgctgaacagctttataaagacttcagccacccctgcacctggcaggtgttggatggggctgaggacaccctgagggagtgccgcacacggggtctgagactggcagtgatctccaactttgaccgacggctagagggcatcctggggggccttggcctgcgtgaacacttcgactttgtgctgacctccgaggctgctggctggcccaagccggacccccgcattttccaggaggccttgcggcttgctcatatggaaccagtagtggcagcccatgttggggataattacctctgcgattaccaggggcctcgggctgtgggcatgcacagcttcctggtggttggcccacaggcactggaccccgtggtcagggattctgtacctaaagaacacatcctcccctctctggcccatctcctgcctgcccttgactgcctagagggctcaactccagggctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytidine monophosphate N-acetylneuraminic acid synthetase
- splA/ryanodine receptor domain and SOCS box containing 2
- major histocompatibility complex, class II, DR beta 1
- major histocompatibility complex, class II, DR beta 3