Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMAS-cytidine monophosphate N-acetylneuraminic acid synthetase Gene
PTXBC016609
New product
Data sheet of CMAS-cytidine monophosphate N-acetylneuraminic acid synthetase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMAS-cytidine monophosphate N-acetylneuraminic acid synthetase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMAS |
| Origin species: | Human |
| Product name: | CMAS-cytidine monophosphate N-acetylneuraminic acid synthetase Gene |
| Size: | 2ug |
| Accessions: | BC016609 |
| Gene id: | 55907 |
| Gene description: | cytidine monophosphate N-acetylneuraminic acid synthetase |
| Synonyms: | CSS; N-acylneuraminate cytidylyltransferase; CMP-N-acetylneuraminic acid synthase; CMP-N-acetylneuraminic acid synthetase; CMP-Neu5Ac synthetase; CMP-NeuNAc synthase; CMP-NeuNAc synthetase; CMP-sialic acid synthetase; cytidine 5'-monophosphate N-acetylneuraminic acid synthetase; cytidine monophosphate N-acetylneuraminic acid synthetase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactcggtggagaagggggccgccacctccgtctccaacccgcgggggcgaccgtcccggggccggccgccgaagctgcagcgcaactctcgcggcggccagggccgaggtgtggagaagcccccgcacctggcagccctaattctggcccggggaggcagcaaaggcatccccctgaagaacattaagcacctggcgggggtcccgctcattggctgggtcctgcgtgcggccctggattcaggggccttccagagtgtatgggtttcgacagaccatgatgaaattgagaatgtggccaaacaatttggtgcacaagttcatcgaagaagttctgaagtttcaaaagacagctctacctcactagatgccatcatagaatttcttaattatcataatgaggttgacattgtaggaaatattcaagctacttctccatgtttacatcctactgatcttcaaaaagttgcagaaatgattcgagaagaaggatatgattctgttttctctgttgtgagacgccatcagtttcgatggagtgaaattcagaaaggagttcgtgaagtgaccgaacctctgaatttaaatccagctaaacggcctcgtcgacaagactgggatggagaattatatgaaaatggctcattttattttgctaaaagacatttgatagagatgggttacttgcagggtggaaaaatggcatactacgaaatgcgagctgaacatagtgtggatatagatgtggatattgattggcctattgcagagcaaagagtattaaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splA/ryanodine receptor domain and SOCS box containing 2 - major histocompatibility complex, class II, DR beta 1 - major histocompatibility complex, class II, DR beta 3 - splA/ryanodine receptor domain and SOCS box containing 4 |