Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPSB4-splA/ryanodine receptor domain and SOCS box containing 4 Gene
PTXBC008324
New product
Data sheet of SPSB4-splA/ryanodine receptor domain and SOCS box containing 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPSB4-splA/ryanodine receptor domain and SOCS box containing 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008324 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPSB4 |
| Origin species: | Human |
| Product name: | SPSB4-splA/ryanodine receptor domain and SOCS box containing 4 Gene |
| Size: | 2ug |
| Accessions: | BC008324 |
| Gene id: | 92369 |
| Gene description: | splA/ryanodine receptor domain and SOCS box containing 4 |
| Synonyms: | SSB-4; SSB4; SPRY domain-containing SOCS box protein 4; SPRY domain-containing SOCS box protein SSB-4; splA/ryanodine receptor domain and SOCS box containing 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggccagaagctctcggggagcctcaagtcagtggaggtgcgagagccggcgctgcggccggccaagcgggagctgcggggtgcagagcccgggcggccggcgcggctggaccagctgttggacatgccagcggcggggctggctgtgcagctgcggcacgcgtggaaccccgaggaccgctcgctcaacgtcttcgtcaaggacgacgaccggctcaccttccaccggcaccccgtggcccagagcaccgacggcatccgcggcaaggtgggccacgcccgcggcctgcacgcctggcagatcaactggccggctcggcagcgcggcacccacgctgtagttggtgtggccacggcccgtgctcccctgcactccgtgggctacacggcgctggtaggcagtgacgccgagtcgtggggctgggacctgggccgcagccgcctctaccacgacggcaagaaccagcccggcgtggcctacccggcctttctggggcccgacgaggcctttgcgctgcccgactcgctgctcgtggtgctggacatggatgagggcacactcagcttcatcgtggatggccagtacctgggcgtggccttccgaggtctcaagggcaagaagctgtacccggtggtgagtgccgtgtggggccactgtgaagtcaccatgcgctacatcaacggccttgaccccgagcccctgccactgatggacctgtgccggagatccatccgctcggccctgggccgccagcgcctgcaggacatcagctccctgcccctgcctcagtctctcaaaaactatctgcagtaccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splA/ryanodine receptor domain and SOCS box containing 1 - protein phosphatase 1, regulatory (inhibitor) subunit 7 - ganglioside-induced differentiation-associated protein 1 - MMS19 nucleotide excision repair homolog (S. cerevisiae) |