GDAP1-ganglioside-induced differentiation-associated protein 1 Gene View larger

GDAP1-ganglioside-induced differentiation-associated protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDAP1-ganglioside-induced differentiation-associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GDAP1-ganglioside-induced differentiation-associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024939
Product type: DNA & cDNA
Ncbi symbol: GDAP1
Origin species: Human
Product name: GDAP1-ganglioside-induced differentiation-associated protein 1 Gene
Size: 2ug
Accessions: BC024939
Gene id: 54332
Gene description: ganglioside-induced differentiation-associated protein 1
Synonyms: CMT4; CMT4A; CMTRIA; ganglioside-induced differentiation-associated protein 1; Charcot-Marie-Tooth neuropathy 4A; ganglioside induced differentiation associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgtttgaactcaactggagaagtgcctgtccttatccacggggaaaacataatttgtgaggccactcagatcattgattatcttgaacagactttcctggatgaaagaacacccaggttaatgcctgataaagaaagcatgtattacccacgggtacaacattaccgagagctgcttgactccttgccaatggatgcctatacacatggctgcattttacatcctgagttaactgtggactccatgatcccggcttatgcaactacaaggattcgtagccaaattggaaacacagagtctgagctgaagaaacttgctgaagaaaacccagatttacaagaagcatacattgcaaaacagaaacgacttaaatcaaagctgcttgatcatgacaatgtcaagtatttgaagaaaattcttgatgagttggagaaagtcttggatcaggttgaaactgaattgcaaagaagaaatgaagaaaccccagaagagggccagcaaccttggctctgcggtgaatccttcaccctggcagacgtctcactcgctgtcacattgcatcgactgaagttcctggggtttgcaaggagaaactggggaaacggaaagcgaccaaacttggaaacctattacgagcgtgtcttgaagagaaaaacatttaacaaggttttaggacatgtcaacaatatattaatctctgcagtgctgccaacagcattccgggtggccaagaaaagggccccaaaagttcttggcacgacccttgtggttggtttgcttgcaggagtgggatattttgcttttatgcttttcagaaagaggcttggcagcatgatattagcatttagacccagaccaaattatttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MMS19 nucleotide excision repair homolog (S. cerevisiae)
- StAR-related lipid transfer (START) domain containing 7
- capping protein (actin filament) muscle Z-line, alpha 3
- Fc fragment of IgE, low affinity II, receptor for (CD23)

Buy GDAP1-ganglioside-induced differentiation-associated protein 1 Gene now

Add to cart