Login to display prices
Login to display prices
GDAP1-ganglioside-induced differentiation-associated protein 1 Gene View larger

GDAP1-ganglioside-induced differentiation-associated protein 1 Gene

PTXBC024939

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDAP1-ganglioside-induced differentiation-associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDAP1-ganglioside-induced differentiation-associated protein 1 Gene

Proteogenix catalog: PTXBC024939
Ncbi symbol: GDAP1
Product name: GDAP1-ganglioside-induced differentiation-associated protein 1 Gene
Size: 2ug
Accessions: BC024939
Gene id: 54332
Gene description: ganglioside-induced differentiation-associated protein 1
Synonyms: CMT4; CMT4A; CMTRIA; ganglioside-induced differentiation-associated protein 1; Charcot-Marie-Tooth neuropathy 4A; ganglioside induced differentiation associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgtttgaactcaactggagaagtgcctgtccttatccacggggaaaacataatttgtgaggccactcagatcattgattatcttgaacagactttcctggatgaaagaacacccaggttaatgcctgataaagaaagcatgtattacccacgggtacaacattaccgagagctgcttgactccttgccaatggatgcctatacacatggctgcattttacatcctgagttaactgtggactccatgatcccggcttatgcaactacaaggattcgtagccaaattggaaacacagagtctgagctgaagaaacttgctgaagaaaacccagatttacaagaagcatacattgcaaaacagaaacgacttaaatcaaagctgcttgatcatgacaatgtcaagtatttgaagaaaattcttgatgagttggagaaagtcttggatcaggttgaaactgaattgcaaagaagaaatgaagaaaccccagaagagggccagcaaccttggctctgcggtgaatccttcaccctggcagacgtctcactcgctgtcacattgcatcgactgaagttcctggggtttgcaaggagaaactggggaaacggaaagcgaccaaacttggaaacctattacgagcgtgtcttgaagagaaaaacatttaacaaggttttaggacatgtcaacaatatattaatctctgcagtgctgccaacagcattccgggtggccaagaaaagggccccaaaagttcttggcacgacccttgtggttggtttgcttgcaggagtgggatattttgcttttatgcttttcagaaagaggcttggcagcatgatattagcatttagacccagaccaaattatttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: