Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CAPZA3-capping protein (actin filament) muscle Z-line, alpha 3 Gene
PTXBC016745
New product
Data sheet of CAPZA3-capping protein (actin filament) muscle Z-line, alpha 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAPZA3-capping protein (actin filament) muscle Z-line, alpha 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016745 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAPZA3 |
| Origin species: | Human |
| Product name: | CAPZA3-capping protein (actin filament) muscle Z-line, alpha 3 Gene |
| Size: | 2ug |
| Accessions: | BC016745 |
| Gene id: | 93661 |
| Gene description: | capping protein (actin filament) muscle Z-line, alpha 3 |
| Synonyms: | CAPPA3; Gsg3; HEL-S-86; F-actin-capping protein subunit alpha-3; CP-alpha-3; CapZ alpha-3; F-actin capping protein alpha-3 subunit; capping protein (actin filament) muscle Z-line, alpha 3; epididymis secretory protein Li 86; germ cell-specific protein 3; testis tissue sperm-binding protein Li 73n; capping actin protein of muscle Z-line alpha subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacacttagcgtgctgagcaggaaggacaaggaaagagtaattcgcagactgttattacaggcccctccaggggaatttgtaaatgcctttgatgatctctgtctgcttatccgtgatgaaaaacttatgcaccaccaaggtgagtgtgcaggccaccaacactgccaaaaatattctgtaccactctgcatcgatggaaatccagtactcttgtctcaccacaatgtaatgggcgactaccgattttttgaccatcaaagcaaactttctttcaaatattacctgcttcaaaatcagctgaaagacatccaaagtcatggtatcattcagaatgaggcagaatacctgagagttgttcttctgtgcgccttaaaactgtatgtgaatgaccactatccaaaaggaaattgcaacatgctgagaaaaactgtcaaaagtaaggagtacttgatagcttgcattgaagatcacaactatgaaacaggagagtgctggaacggactttggaaatctaaatggattttccaagttaacccatttctaacccaagtaacgggaagaatatttgtgcaagctcacttcttcaggtgtgtcaaccttcatattgaaatatccaaggacctgaaagaaagcttggaaatagttaaccaagctcaactggctctaagttttgcaaggcttgtggaagagcaagagaacaaatttcaagctgcagtcttggaagaattacaggagttatccaatgaagccctgagaaaaattctacgaagggatcttccagtgacccgcactcttattgactggcacaggatactctctgacttgaatctggtgatgtatcctaaattaggatatgtcatttattcaagaagtgtgttgtgcaactggataatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fc fragment of IgE, low affinity II, receptor for (CD23) - protein phosphatase 1, catalytic subunit, alpha isoform - RNA (guanine-9-) methyltransferase domain containing 2 - synapse associated protein 1, SAP47 homolog (Drosophila) |