SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene View larger

SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014657
Product type: DNA & cDNA
Ncbi symbol: SYAP1
Origin species: Human
Product name: SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene
Size: 2ug
Accessions: BC014657
Gene id: 94056
Gene description: synapse associated protein 1, SAP47 homolog (Drosophila)
Synonyms: PRO3113; synapse-associated protein 1; SAP47 homolog; synapse associated protein 1, SAP47 homolog; synapse associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccggggcttgagcagttggttgggcttgcagcagccggtggcaggcggtgggcagcccaatggagatgctctacccgagcagccgtccgagacggtggctgagtctgcggaggaggagctgcagcaagcgggagaccaggagctcctccaccaggccaaagacttcggcaactatttatttaactttgcatctgctgccacaaaaaagataactgaatcagttgctgaaacagcacaaacaataaagaaatccgtagaagaaggaaaaatagatggcatcattgacaagacaattataggagattttcagaaggaacagaaaaaatttgttgaagagcaacatacaaagaagtcagaagcagctgtgcccccatgggttgacactaacgatgaagaaacaattcaacaacaaattttggccttatcagctgacaagaggaatttccttcgtgaccctccggctggcgtgcaatttaatttcgactttgatcagatgtaccccgtggccctggtcatgctccaggaggatgagctgctaagcaagatgagatttgccctcgttcctaaacttgtgaaggaagaagtgttctggaggaactacttttaccgcgtctccctgattaagcagtcagcccagctcacggccctggctgcccaacagcaggccgcagggaaggaggagaagagcaatggcagagagcaagatttgccgctggcagaggcagtacggcccaaaacgccacccgttgtaatcaaatctcagcttaaaactcaagaggatgaggaagaaatttctactagcccaggtgtttctgagtttgtcagtgatgccttcgatgcctgtaacctaaatcaggaagatctaaggaaagaaatggagcaactagtgcttgacaaaaagcaagaggagacagccgtactggaagaggattctgcagattgggaaaaagaactgcagcaggaacttcaagaatatgaagtggtgacagaatctgaaaaacgagatgaaaactgggataaggaaatagagaaaatgcttcaagaggaaaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, regulatory (inhibitor) subunit 7
- GA binding protein transcription factor, beta subunit 1
- guanine nucleotide binding protein (G protein), alpha 13
- KIN, antigenic determinant of recA protein homolog (mouse)

Buy SYAP1-synapse associated protein 1, SAP47 homolog (Drosophila) Gene now

Add to cart