Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GABPB1-GA binding protein transcription factor, beta subunit 1 Gene
PTXBC016910
New product
Data sheet of GABPB1-GA binding protein transcription factor, beta subunit 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABPB1-GA binding protein transcription factor, beta subunit 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016910 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABPB1 |
| Origin species: | Human |
| Product name: | GABPB1-GA binding protein transcription factor, beta subunit 1 Gene |
| Size: | 2ug |
| Accessions: | BC016910 |
| Gene id: | 2553 |
| Gene description: | GA binding protein transcription factor, beta subunit 1 |
| Synonyms: | BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2; GA-binding protein subunit beta-1; GA binding protein transcription factor beta subunit 1 transcript variant gamma-2; GABP subunit beta-2; nuclear respiratory factor 2; transcription factor E4TF1-47; transcription factor E4TF1-53; GA binding protein transcription factor beta subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctggtagatttgggaaagaagcttttagaagcggcacgagcaggtcaagatgatgaagttcgtattttgatggcaaatggagctccctttactacagactggctgggaacttctccacttcatctagcagcacagtatggtcattattccaccacagaggtactgctgcgagctggtgtgagcagagatgccagaaccaaagtggaccgaacaccattacatatggcagcttctgagggccatgccagcatagtagaggttttacttaagcatggtgctgatgtcaatgcaaaggacatgttaaagatgacagctctccattgggccacagaacacaatcatcaagaggtggtggaacttttaatcaaatatggtgctgatgtacacacgcaaagtaaattttgtaaaactgcatttgatatttcaatagacaatggaaatgaagatttagcagagatattacagattgctatgcagaaccaaatcaacacaaacccagagagtcctgacactgtgacaatacatgctgcaacaccacagtttatcattggacctggaggggtggtgaacctaacaggtctggtatcttcagaaaattcatccaaggcaacagatgaaacgggtgtatctgctgttcagtttggaaactcttctacatcagtattagctacattagctgccttagctgaagcatctgctccattgtccaattcttcagaaactccagtagtggccacagaagaagtagttactgcagaatctgtggatggtgccattcagcaagtagttagttcagggggtcagcaagtcatcacaatagttacagatggaattcagcttggaaatttgcactctattccaaccagtggaattggtcagcccatcattgtgaccatgccagatggacaacaagtattaacagtaccagcaacagacattgctgaagaaactgttataagtgaagaaccaccagctaagagacaatgtatcgaaataattgaaaaccgggtggaatctgcagaaatagaagtaaggagtcttttacccggtgtgctttgccgcagtcatccaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha 13 - KIN, antigenic determinant of recA protein homolog (mouse) - G protein-coupled receptor, family C, group 5, member B - RNA binding motif, single stranded interacting protein 2 |