GABPB1-GA binding protein transcription factor, beta subunit 1 Gene View larger

GABPB1-GA binding protein transcription factor, beta subunit 1 Gene

PTXBC016910

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABPB1-GA binding protein transcription factor, beta subunit 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GABPB1-GA binding protein transcription factor, beta subunit 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016910
Product type: DNA & cDNA
Ncbi symbol: GABPB1
Origin species: Human
Product name: GABPB1-GA binding protein transcription factor, beta subunit 1 Gene
Size: 2ug
Accessions: BC016910
Gene id: 2553
Gene description: GA binding protein transcription factor, beta subunit 1
Synonyms: BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2; GA-binding protein subunit beta-1; GA binding protein transcription factor beta subunit 1 transcript variant gamma-2; GABP subunit beta-2; nuclear respiratory factor 2; transcription factor E4TF1-47; transcription factor E4TF1-53; GA binding protein transcription factor beta subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccctggtagatttgggaaagaagcttttagaagcggcacgagcaggtcaagatgatgaagttcgtattttgatggcaaatggagctccctttactacagactggctgggaacttctccacttcatctagcagcacagtatggtcattattccaccacagaggtactgctgcgagctggtgtgagcagagatgccagaaccaaagtggaccgaacaccattacatatggcagcttctgagggccatgccagcatagtagaggttttacttaagcatggtgctgatgtcaatgcaaaggacatgttaaagatgacagctctccattgggccacagaacacaatcatcaagaggtggtggaacttttaatcaaatatggtgctgatgtacacacgcaaagtaaattttgtaaaactgcatttgatatttcaatagacaatggaaatgaagatttagcagagatattacagattgctatgcagaaccaaatcaacacaaacccagagagtcctgacactgtgacaatacatgctgcaacaccacagtttatcattggacctggaggggtggtgaacctaacaggtctggtatcttcagaaaattcatccaaggcaacagatgaaacgggtgtatctgctgttcagtttggaaactcttctacatcagtattagctacattagctgccttagctgaagcatctgctccattgtccaattcttcagaaactccagtagtggccacagaagaagtagttactgcagaatctgtggatggtgccattcagcaagtagttagttcagggggtcagcaagtcatcacaatagttacagatggaattcagcttggaaatttgcactctattccaaccagtggaattggtcagcccatcattgtgaccatgccagatggacaacaagtattaacagtaccagcaacagacattgctgaagaaactgttataagtgaagaaccaccagctaagagacaatgtatcgaaataattgaaaaccgggtggaatctgcagaaatagaagtaaggagtcttttacccggtgtgctttgccgcagtcatccaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha 13
- KIN, antigenic determinant of recA protein homolog (mouse)
- G protein-coupled receptor, family C, group 5, member B
- RNA binding motif, single stranded interacting protein 2

Buy GABPB1-GA binding protein transcription factor, beta subunit 1 Gene now

Add to cart