RBMS2-RNA binding motif, single stranded interacting protein 2 Gene View larger

RBMS2-RNA binding motif, single stranded interacting protein 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMS2-RNA binding motif, single stranded interacting protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBMS2-RNA binding motif, single stranded interacting protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027863
Product type: DNA & cDNA
Ncbi symbol: RBMS2
Origin species: Human
Product name: RBMS2-RNA binding motif, single stranded interacting protein 2 Gene
Size: 2ug
Accessions: BC027863
Gene id: 5939
Gene description: RNA binding motif, single stranded interacting protein 2
Synonyms: SCR3; RNA-binding motif, single-stranded-interacting protein 2; suppressor of CDC2 with RNA-binding motif 3; RNA binding motif single stranded interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctatccgtgacttccaggcccgggatttcgacttttggctacaatagaaacaacaagaagccatatgtgtcactggctcagcagatggcaccacctagcccaagcaacagtacacctaacagcagtagtggaagcaatggaaatgaccagctgagcaaaaccaacctatacatccgaggattgcaaccaggcactactgaccaagatcttgtcaagctgtgtcagccatatggcaagattgtttccactaaggccatactggacaagaccacaaacaaatgtaaaggctatggctttgtagattttgacagcccttcagcagcacagaaagctgtaacagcactgaaggccagcggtgtacaggcacagatggcaaagcaacaggaacaggaccccacaaatttatacatctcaaacctcccactgtcaatggatgagcaggaactggaggggatgctgaagccctttggccaggttatctccacccgtatccttcgagataccagtgggaccagcagaggtgttggctttgcaaggatggagtccacagagaagtgtgaagccatcatcacccactttaatggaaaatatattaagacaccccctggagtaccagccccatccgatcccttgctttgcaaatttgctgatggcgggccaaagaaacgacagaaccaaggaaaatttgtgcaaaatggacgggcttggccaaggaatgcagacatgggcgtcatggccttgacctatgaccccaccacagctcttcagaatgggttttacccagccccctataacatcacccccaacaggatgcttgctcagtctgcactctccccatacctttcctctcctgtgtcttcgtatcagagagtgactcagacatctcctctacaagtacctaacccatcctggatgcaccaccattcatacctcatgcagccttcaggttcagttctgacaccagggatggaccatcccatttctctccagcctgcctccatgatgggaccccttacccagcaactgggccatctctccctcagcagcacaggcacgtatatgccgacggctgcagctatgcaaggagcttacatctcccagtacacccctgtgccttcttccagtgtttcagtcgaggagagcagcggccaacagaaccaagtggcagtggacgcaccctcagagcatggggtctattctttccagttcaacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin superfamily containing leucine-rich repeat
- G protein-coupled receptor, family C, group 5, member C
- StAR-related lipid transfer (START) domain containing 3
- GA binding protein transcription factor, beta subunit 2

Buy RBMS2-RNA binding motif, single stranded interacting protein 2 Gene now

Add to cart