GABPB2-GA binding protein transcription factor, beta subunit 2 Gene View larger

GABPB2-GA binding protein transcription factor, beta subunit 2 Gene

PTXBC027033

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABPB2-GA binding protein transcription factor, beta subunit 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GABPB2-GA binding protein transcription factor, beta subunit 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027033
Product type: DNA & cDNA
Ncbi symbol: GABPB2
Origin species: Human
Product name: GABPB2-GA binding protein transcription factor, beta subunit 2 Gene
Size: 2ug
Accessions: BC027033
Gene id: 126626
Gene description: GA binding protein transcription factor, beta subunit 2
Synonyms: GABPB-2; GA-binding protein subunit beta-2; GABP subunit beta-2; GA binding protein transcription factor beta subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttggtggacttgggaaagaggttgctagaagcagcaagaaaaggccaagatgatgaagtgagaacgttgatggcaaatggcgccccattcaccacagactggcttggaacatcacccctccaccttgcagctcaatatggtcattattccacagcagaagtactccttcgagcaggtgttagcagggatgcccggactaaagtagacaggacccccttgcacatggctgcagccgatggacatgcgcacatcgtggaactgcttgttcggaatggtgcagatgtgaatgccaaggacatgctgaagatgacagctttgcattgggccacagagcgccaccatcgagatgtcgtagagttacttatcaaatatggagctgatgtccatgctttcagcaaatttgataaatcagcctttgacatagctctggagaaaaacaatgctgagattttggtcatcctccaggaagcaatgcagaatcaggtgaatgttaatccagagagagccaaccctgtgactgaccctgtgagtatggctgctccattcatcttcacgtcgggtgaggttgttaacctcgcaagccttatttcttcaaccaacaccaaaacaacctcaggtgacccccatgcctcaacagtacagttttcaaattctaccacctcagtgctggctacccttgcagctcttgctgaggcatcagtccccctctccaactcacacagagccacagccaatacagaggaaattatagaaggaaattccgttgactcatcaatccagcaagtaatggggagtggaggccagagggtcatcaccatagtgactgatggagtccctctgggtaatatccaaacttcaatccctactggaggcattggccagccatttattgtaactgtgcaagatggacagcaagttctaactgtacctgctggtaaggttgcagaggagactgtaattaaagaggaagaagaagagaagttgccactaacaaagaaaccaaggataggagagaagacaaacagtgtggaggaaagcaaggaaggcaatgaaagagagctactacagcaacaactccaggaggccaatcgaagagcccaggaataccgacaccagctcctaaagaaagagcaggaagcagaacagtaccgtcttaagctggaggccatagcccgacagcagcccaatggagttgatttcaccatggttgaagaggtggctgaggtagatgctgtagtagtcacagagggggagttggaagagagagagacaaaagtgactgggtcagcagggaccacagagcctcacactagagtttccatggcaactgtttcatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 1A
- phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
- GTPase activating protein (SH3 domain) binding protein 1
- RNA binding motif protein, Y-linked, family 1, member F

Buy GABPB2-GA binding protein transcription factor, beta subunit 2 Gene now

Add to cart