Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
G3BP1-GTPase activating protein (SH3 domain) binding protein 1 Gene
PTXBC006997
New product
Data sheet of G3BP1-GTPase activating protein (SH3 domain) binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about G3BP1-GTPase activating protein (SH3 domain) binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006997 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | G3BP1 |
| Origin species: | Human |
| Product name: | G3BP1-GTPase activating protein (SH3 domain) binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC006997 |
| Gene id: | 10146 |
| Gene description: | GTPase activating protein (SH3 domain) binding protein 1 |
| Synonyms: | HDH-VIII; ras GTPase-activating protein-binding protein 1; ATP-dependent DNA helicase VIII; DNA helicase VIII; G3BP-1; GAP SH3 domain-binding protein 1; GAP binding protein; GTPase activating protein (SH3 domain) binding protein 1; Ras-GTPase-activating protein SH3-domain-binding protein; RasGAP-associated endoribonuclease G3BP; G3BP stress granule assembly factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgatggagaagcctagtcccctgctggtcgggcgggaatttgtgagacagtattacacactgctgaaccaggccccagacatgctgcatagattttatggaaagaactcttcttatgtccatgggggattggattcaaatggaaagccagcagatgcagtctacggacagaaagaaatccacaggaaagtgatgtcacaaaacttcaccaactgccacaccaagattcgccatgttgatgctcatgccacgctaaatgatggtgtggtagtccaggtgatggggcttctctctaacaacaaccaggctttgaggagattcatgcaaacgtttgtccttgctcctgaggggtctgttgcaaataaattctatgttcacaatgatatcttcagataccaagatgaggtctttggtgggtttgtcactgagcctcaggaggagtctgaagaagaagtagaggaacctgaagaaagacagcaaacacctgaggtggtacctgatgattctggaactttctatgatcaggcagttgtcagtaatgacatggaagaacatttagaggagcctgttgctgaaccagagcctgatcctgaaccagaaccagaacaagaacctgtatctgaaatccaagaggaaaagcctgagccagtattagaagaaactgcccctgaggatgctcagaagagttcttctccagcacctgcagacatagctcagacagtacaggaagacttgaggacattttcttgggcatctgtgaccagtaagaatcttccacccagtggagctgttccagttactgggataccacctcatgttgttaaagtaccagcttcacagccccgtccagagtctaagcctgaatctcagattccaccacaaagacctcagcgggatcaaagagtgcgagaacaacgaataaatattcctccccaaaggggacccagaccaatccgtgaggctggtgagcaaggtgacattgaaccccgaagaatggtgagacaccctgacagtcaccaactcttcattggcaacctgcctcatgaagtggacaaatcagagcttaaagatttctttcaaagttatggaaacgtggtggagttgcgcattaacagtggtgggaaattacccaattttggttttgttgtgtttgatgattctgagcctgttcagaaagtccttagcaacaggcccatcatgttcagaggtgaggtccgtctgaatgtcgaagagaagaagactcgagctgccagggaaggcgaccgacgagataatcgccttcggggacctggaggccctcgaggtgggctgggtggtggaatgagaggccctccccgtggaggcatggtgcagaaaccaggatttggagtgggaagggggcttgcgccacggcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein, Y-linked, family 1, member F - ganglioside induced differentiation associated protein 2 - pyridine nucleotide-disulphide oxidoreductase domain 1 - cytochrome P450, family 51, subfamily A, polypeptide 1 |