CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene View larger

CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene

PTXBC032322

New product

Data sheet of CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC032322
Product type: DNA & cDNA
Ncbi symbol: CYP51A1
Origin species: Human
Product name: CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene
Size: 2ug
Accessions: BC032322
Gene id: 1595
Gene description: cytochrome P450, family 51, subfamily A, polypeptide 1
Synonyms: CP51; CYP51; CYPL1; LDM; P450-14DM; P450L1; lanosterol 14-alpha demethylase; CYPLI; cytochrome P450 51A1; cytochrome P450, 51 (lanosterol 14-alpha-demethylase); cytochrome P450, family 51, subfamily A, polypeptide 1; cytochrome P450-14DM; cytochrome P45014DM; cytochrome P450LI; sterol 14-alpha demethylase; cytochrome P450 family 51 subfamily A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcggctgggatgctgctgctgggcttgctgcaggcgggtgggtcggtgctgggccaggcgatggagaaggtgacaggcggcaacctcttgtccatgctgctgatcgcctgcgccttcaccctcagcctggtctacctgatccgtctggccgccggccacctggtccagctgcccgcaggggtgaaaagtcctccatacattttctccccaattccattccttgggcatgccatagcatttgggaaaagtccaattgaatttctagaaaatgcatatgagaagtatggacctgtatttagttttaccatggtaggcaagacatttacttaccttctggggagtgatgctgctgcactgctttttaatagtaaaaatgaagacctgaatgcagaagatgtctacagtcgcctgacaacacctgtgtttgggaagggagttgcatacgatgtgcctaatccagttttcttggagcagaagaaaatgttaaaaagtggccttaacatagcccactttaaacagcatgtttctataattgaaaaagaaacaaaggaatactttgagagttggggagaaagtggagaaaaaaatgtgtttgaagctctttctgagctcataattttaacagctagccattgtttgcatggaaaggaaatcagaagtcaactcaatgaaaaggtagcacagctgtatgcagatttggatggaggtttcagccatgcagcctggctcttaccaggttggctgcctttgcctagtttcagacgcagggacagagctcatcgggaaatcaaggatattttctataaggcaatccagaaacgcagacagtctcaagaaaaaattgatgacattctccaaactttactagatgctacatacaaggatgggcgtcctttgactgatgatgaagtagcagggatgcttattggattactcttggcagggcagcatacatcctcaactactagtgcttggatgggcttctttttggccagagacaaaacacttcaaaaaaaatgttatttagaacagaaaacagtctgtggagagaatctgcctcctttaacttatgaccagctcaaggatctaaatttacttgatcgctgtataaaagaaacattaagacttagacctcctgtaatgatcatgatgagaatggccagaactcctcagactgtggcagggtataccattcctccaggacatcaggtgtgtgtttctcccactgtcaatcaaagacttaaagactcatgggtagaacgcctggactttaatcctgatcgctacttacaggataacccagcatcaggggaaaagtttgcctatgtgccatttggagctgggcgtcatcgttgtattggggaaaattttgcctatgttcaaattaagacaatttggtccactatgcttcgtttatatgaatttgatctcattgatggatactttcccactgtgaattatacaactatgattcacacccctgaaaacccagttatccgttacaaacgaagatcaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome P450, family 11, subfamily A, polypeptide 1
- cytochrome P450, family 4, subfamily F, polypeptide 12
- TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae)
- polymerase (RNA) II (DNA directed) polypeptide E, 25kDa

Buy CYP51A1-cytochrome P450, family 51, subfamily A, polypeptide 1 Gene now

Add to cart