CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene View larger

CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene

PTXBC035350

New product

Data sheet of CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC035350
Product type: DNA & cDNA
Ncbi symbol: CYP4F12
Origin species: Human
Product name: CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene
Size: 2ug
Accessions: BC035350
Gene id: 66002
Gene description: cytochrome P450, family 4, subfamily F, polypeptide 12
Synonyms: CYPIVF12; F22329_1; cytochrome P450 4F12; cytochrome P450, family 4, subfamily F, polypeptide 12; cytochrome P450, subfamily IVF, polypeptide 12; cytochrome P450 family 4 subfamily F member 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgctgctgagcctgccctggctgggcctcagaccggtggcaatgtccccatggctactcctgctgctggttgtgggctcctggctactcgcccgcatcctggcttggacctatgccttctataacaactgccgccggctccagtgtttcccacagcccccaaaacggaactggttttggggtcacctgggcctgatcactcctacagaggagggcttgaaggactcgacccagatgtcggccacctattcccagggctttacggtatggctgggtcccatcatccccttcatcgttttatgccaccctgacaccatccggtctatcaccaatgcctcagctgccattgcacccaaggataatctcttcatcaggttcctgaagccctggctgggagaagggatactgctgagtggcggtgacaagtggagccgccaccgtcggatgctgacgcccgccttccatttcaacatcctgaagtcctatataacgatcttcaacaagagtgcaaacatcatgcttgacaagtggcagcacctggcctcagagggcagcagttgtctggacatgtttgagcacatcagcctcatgaccttggacagtctacagaaatgcatcttcagctttgacagccattgtcaggagaggcccagtgaatatattgccaccatcttggagctcagtgcccttgtagagaaaagaagccagcatatcctccagcacatggactttctgtattacctctcccatgacgggcggcgcttccacagggcctgccgcctggtgcatgacttcacagacgctgtcatccgggagcggcgtcgcaccctccccactcagggtattgatgattttttcaaagacaaagccaagtccaagactttggatttcattgatgtgcttctgctgagcaaggatgaagatgggaaggcattgtcagatgaggatataagagcagaggctgacaccttcatgtttggaggccatgacaccacggccagtggcctctcctgggtcctgtacaaccttgcgaggcacccagaataccaggagcgctgccgacaggaggtgcaagagcttctgaaggaccgcgatcctaaagagattgaatgggacgacctggcccagctgcccttcctgaccatgtgcgtgaaggagagcctgaggttacatcccccagctcccttcatctcccgatgctgcacccaggacattgttctcccagatggccgagtcatccccaaaggcattacctgcctcatcgatattataggggtccatcacaacccaactgtgtggccggatcctgaggtctacgaccccttccgctttgacccagagaacagcaaggggaggtcacctctggcttttattcctttttccgcagggcccaggaactgcatcgggcaggcgttcgccatggcggagatgaaagtggtcctggcgttgatgctgctgcacttccggttcctgccagaccacactgagccccgcaggaagctggaattgatcatgcgcgccgagggcgggctttggctgcgggtggagcccctgaatgtaagcttgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae)
- polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
- protein phosphatase 1, regulatory (inhibitor) subunit 2
- papillary renal cell carcinoma (translocation-associated)

Buy CYP4F12-cytochrome P450, family 4, subfamily F, polypeptide 12 Gene now

Add to cart