Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF1A-tumor necrosis factor receptor superfamily, member 1A Gene
PTXBC010140
New product
Data sheet of TNFRSF1A-tumor necrosis factor receptor superfamily, member 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF1A-tumor necrosis factor receptor superfamily, member 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010140 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF1A |
| Origin species: | Human |
| Product name: | TNFRSF1A-tumor necrosis factor receptor superfamily, member 1A Gene |
| Size: | 2ug |
| Accessions: | BC010140 |
| Gene id: | 7132 |
| Gene description: | tumor necrosis factor receptor superfamily, member 1A |
| Synonyms: | CD120a; FPF; TBP1; TNF-R; TNF-R-I; TNF-R55; TNFAR; TNFR55; TNFR60; p55; p55-R; p60; tumor necrosis factor receptor superfamily member 1A; TNF-R1; TNF-RI; TNFR-I; tumor necrosis factor binding protein 1; tumor necrosis factor receptor 1A isoform beta; tumor necrosis factor receptor type 1; tumor necrosis factor-alpha receptor; TNF receptor superfamily member 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctctccaccgtgcctgacctgctgctgccactggtgctcctggagctgttggtgggaatatacccctcaggggttattggactggtccctcacctaggggacagggagaagagagatagtgtgtgtccccaaggaaaatatatccaccctcaaaataattcgatttgctgtaccaagtgccacaaaggaacctacttgtacaatgactgtccaggcccggggcaggatacggactgcagggagtgtgagagcggctccttcaccgcttcagaaaaccacctcagacactgcctcagctgctccaaatgccgaaaggaaatgggtcaggtggagatctcttcttgcacagtggaccgggacaccgtgtgtggctgcaggaagaaccagtaccggcattattggagtgaaaaccttttccagtgcttcaattgcagcctctgcctcaatgggaccgtgcacctctcctgccaggagaaacagaacaccgtgtgcacctgccatgcaggtttctttctaagagaaaacgagtgtgtctcctgtagtaactgtaagaaaagcctggagtgcacgaagttgtgcctaccccagattgagaatgttaagggcactgaggactcaggcaccacagtgctgttgcccctggtcattttctttggtctttgccttttatccctcctcttcattggtttaatgtatcgctaccaacggtggaagtccaagctctactccattgtttgtgggaaatcgacacctgaaaaagagggggagcttgaaggaactactactaagcccctggccccaaacccaagcttcagtcccactccaggcttcacccccaccctgggcttcagtcccgtgcccagttccaccttcacctccagctccacctatacccccggtgactgtcccaactttgcggctccccgcagagaggtggcaccaccctatcagggggctgaccccatccttgcgacagccctcgcctccgaccccatccccaacccccttcagaagtgggaggacagcgcccacaagccacagagcctagacactgatgaccccgcgacgctgtacgccgtggtggagaacgtgcccccgttgcgctggaaggaattcgtgcggcgcctagggctgagcgaccacgagatcgatcggctggagctgcagaacgggcgctgcctgcgcgaggcgcaatacagcatgctggcgacctggaggcggcgcacgccgcggcgcgaggccacgctggagctgctgggacgcgtgctccgcgacatggacctgctgggctgcctggaggacatcgaggaggcgctttgcggccccgccgccctcccgcccgcgcccagtcttctcagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoinositide-3-kinase, regulatory subunit 3 (gamma) - GTPase activating protein (SH3 domain) binding protein 1 - RNA binding motif protein, Y-linked, family 1, member F - ganglioside induced differentiation associated protein 2 |