ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene View larger

ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022478
Product type: DNA & cDNA
Ncbi symbol: ISLR
Origin species: Human
Product name: ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene
Size: 2ug
Accessions: BC022478
Gene id: 3671
Gene description: immunoglobulin superfamily containing leucine-rich repeat
Synonyms: HsT17563; Meflin; immunoglobulin superfamily containing leucine-rich repeat protein; mesenchymal stromal cell- and fibroblast-expressing Linx paralogue; immunoglobulin superfamily containing leucine rich repeat
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggagctgcatctgctctggtgggcgcttctcctgggcctggctcaggcctgccctgagccctgcgactgtggggaaaagtatggcttccagatcgccgactgtgcctaccgcgacctagaatccgtgccgcctggcttcccggccaatgtgactacactgagcctgtcagccaaccggctgccaggcttgccggagggtgccttcagggaggtgcccctgctgcagtcgctgtggctggcacacaatgagatccgcacggtggccgccggagccctggcctctctgagccatctcaagagcctggacctcagccacaatctcatctctgactttgcctggagcgacctgcacaacctcagtgccctccaattgctcaagatggacagcaacgagctgaccttcatcccccgcgacgccttccgcagcctccgtgctctgcgctcgctgcaactcaaccacaaccgcttgcacacattggccgagggcaccttcaccccgctcaccgcgctgtcccacctgcagatcaacgagaaccccttcgactgcacctgcggcatcgtgtggctcaagacatgggccctgaccacggccgtgtccatcccggagcaggacaacatcgcctgcacctcaccccatgtgctcaagggtacaccgctgagccgcctgccgccactgccatgctcggcgccctcagtgcagctcagctaccaacccagccaggatggtgccgagctgcggcctggttttgtgctggcactgcactgtgatgtggacgggcagccggcccctcagcttcactggcacatccagatacccagtggcattgtggagatcaccagccccaacgtgggcactgatgggcgtgccctgcctggcacccctgtggccagctcccagccgcgcttccaggcctttgccaatggcagcctgcttatccccgactttggcaagctggaggaaggcacctacagctgcctggccaccaatgagctgggcagtgctgagagctcagtggacgtggcactggccacgcccggtgagggtggtgaggacacactggggcgcaggttccatggcaaagcggttgagggaaagggctgctatacggttgacaacgaggtgcagccatcagggccggaggacaatgtggtcatcatctacctcagccgtgctgggaaccctgaggctgcagtcgcagaaggggtccctgggcagctgcccccaggcctgctcctgctgggccaaagcctcctcctcttcttcttcctcacctccttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor, family C, group 5, member C
- StAR-related lipid transfer (START) domain containing 3
- GA binding protein transcription factor, beta subunit 2
- tumor necrosis factor receptor superfamily, member 1A

Buy ISLR-immunoglobulin superfamily containing leucine-rich repeat Gene now

Add to cart