GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene View larger

GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016860
Product type: DNA & cDNA
Ncbi symbol: GPRC5C
Origin species: Human
Product name: GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene
Size: 2ug
Accessions: BC016860
Gene id: 55890
Gene description: G protein-coupled receptor, family C, group 5, member C
Synonyms: RAIG-3; RAIG3; G-protein coupled receptor family C group 5 member C; orphan G-protein coupled receptor; retinoic acid responsive gene protein; retinoic acid-induced gene 3 protein; G protein-coupled receptor class C group 5 member C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatccacaaagccttggtgatgtgcctgggactgcctctcttcctgttcccaggggcctgggcccagggccatgtcccacccggctgcagccaaggcctcaaccccctgtactacaacctgtgtgaccgctctggggcgtggggcatcgtcctggaggccgtggctggggcgggcattgtcaccacgtttgtgctcaccatcatcctggtggccagcctcccctttgtgcaggacaccaagaaacggagcctgctggggacccaggtattcttccttctggggaccctgggcctcttctgcctcgtgtttgcctgtgtggtgaagcccgacttctccacctgtgcctctcggcgcttcctctttggggttctgttcgccatctgcttctcttgtctggcggctcacgtctttgccctcaacttcctggcccggaagaaccacgggccccggggctgggtgatcttcactgtggctctgctgctgaccctggtagaggtcatcatcaatacagagtggctgatcatcaccctggttcggggcagtggcgagggcggccctcagggcaacagcagcgcaggctgggccgtggcctccccctgtgccatcgccaacatggactttgtcatggcactcatctacgtcatgctgctgctgctgggtgccttcctgggggcctggcccgccctgtgtggccgctacaagcgctggcgtaagcatggggtctttgtgctcctcaccacagccacctccgttgccatatgggtggtgtggatcgtcatgtatacttacggcaacaagcagcacaacagtcccacctgggatgaccccacgctggccatcgccctcgccgccaatgcctgggccttcgtcctcttctacgtcatccccgaggtctcccaggtgaccaagtccagcccagagcaaagctaccagggggacatgtaccccacccggggcgtgggctatgagaccatcctgaaagagcagaagggtcagagcatgttcgtggagaacaaggccttttccatggatgagccggttgcagctaagaggccggtgtcaccatacagcgggtacaatgggcagctgctgaccagtgtgtaccagcccactgagatggccctgatgcacaaagttccgtccgaaggagcttacgacatcatcctcccacgggccaccgccaacagccaggtgatgggcagtgccaactcgaccctgcgggctgaagacatgtactcggcccagagccaccaggcggccacaccgccgaaagacggcaagaactctcaggtctttagaaacccctacgtgtgggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - StAR-related lipid transfer (START) domain containing 3
- GA binding protein transcription factor, beta subunit 2
- tumor necrosis factor receptor superfamily, member 1A
- phosphoinositide-3-kinase, regulatory subunit 3 (gamma)

Buy GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene now

Add to cart