Login to display prices
Login to display prices
KIN-KIN, antigenic determinant of recA protein homolog (mouse) Gene View larger

KIN-KIN, antigenic determinant of recA protein homolog (mouse) Gene

PTXBC017309

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIN-KIN, antigenic determinant of recA protein homolog (mouse) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIN-KIN, antigenic determinant of recA protein homolog (mouse) Gene

Proteogenix catalog: PTXBC017309
Ncbi symbol: KIN
Product name: KIN-KIN, antigenic determinant of recA protein homolog (mouse) Gene
Size: 2ug
Accessions: BC017309
Gene id: 22944
Gene description: KIN, antigenic determinant of recA protein homolog (mouse)
Synonyms: KIN, antigenic determinant of recA protein homolog; BTCD; KIN17; Rts2; DNA/RNA-binding protein KIN17; binding to curved DNA; Kin17 DNA and RNA binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaagtcggattttcttactcccaaggctatcgccaacaggatcaagtccaaggggctgcagaagctacgctggtattgccagatgtgccagaagcagtgccgggacgagaatggctttaagtgtcattgtatgtccgaatctcatcagagacaactattgctggcttcagaaaatcctcagcagtttatggattatttttcagaggaattccgaaatgactttctagaacttctcaggagacgctttggcactaaaagggtccacaacaacattgtctacaacgaatacatcagccaccgagagcacatccacatgaatgccactcagtgggaaactctgactgattttactaagtggctgggcagagaaggcttgtgcaaagtggacgagacaccaaaaggctggtatattcagtacatagacagggacccagaaactatccgccggcaactggaactggagaaaaagaaaaagcaggaccttgatgatgaagaaaaaactgccaaatttattgaagagcaagtgagaagaggcctggaagggaaggaacaggaggtccctacttttacggaattaagcagagaaaatgatgaagagaaagtcacgtttaatttgagtaaaggagcatgtagctcatccggagcaacatcttccaagtcaagtactctgggaccgagtgcactgaagacgataggaagttcagcatcagtgaaacgaaaagaatcttcccagagctcaactcagtctaaagaaaagaagaaaaagaaatctgcactggatgaaatcatggagattgaagaggaaaagaaaagaactgcccgaacagactactggctacagcctgaaattattgtgaaaattataaccaagaaactgggagagaaatatcataagaaaaaggctattgttaaggaagtaattgacaaatatacagctgttgtgaagatgattgattctggagacaagctgaaacttgaccagactcatttagagacagtaattccagcaccaggaaaaagaattctagttttaaatggaggctacagaggaaatgaaggtaccctagaatccatcaatgagaagactttttcagctactatcgtcattgaaactggccctttaaaaggacgcagagttgaaggaattcaatatgaagacatttctaaacttgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: