Cart 1 Product Products 113,40 € (empty)
-
1 x FBXL21-F-b...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene
PTXBC034467
New product
Data sheet of GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034467 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPRC5B |
| Origin species: | Human |
| Product name: | GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene |
| Size: | 2ug |
| Accessions: | BC034467 |
| Gene id: | 51704 |
| Gene description: | G protein-coupled receptor, family C, group 5, member B |
| Synonyms: | RAIG-2; RAIG2; G-protein coupled receptor family C group 5 member B; G protein-coupled receptor, family C, group 1, member B; retinoic acid responsive gene protein; retinoic acid-induced gene 2 protein; G protein-coupled receptor class C group 5 member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgtggcatcagagagaaagatgagagctcaccaggtgctcaccttcctcctgctcttcgtgatcacctcggtggcctctgaaaacgccagcacatcccgaggctgtgggctggacctcctccctcagtacgtgtccctgtgcgacctggacgccatctggggcattgtggtggaggcggtggccggggcgggcgccctgatcacactgctcctgatgctcatcctcctggtgcggctgcccttcatcaaggagaaggagaagaagagccctgtgggcctccactttctgttcctcctggggaccctgggcctctttgggctgacgtttgccttcatcatccaggaggacgagaccatctgctctgtccgccgcttcctctggggcgtcctctttgcgctctgcttctcctgcctgctgagccaggcatggcgcgtgcggaggctggtgcggcatggcacgggccccgcgggctggcagctggtgggcctggcgctgtgcctgatgctggtgcaagtcatcatcgctgtggagtggctggtgctcaccgtgctgcgtgacacaaggccagcctgcgcctacgagcccatggactttgtgatggccctcatctacgacatggtactgcttgtggtcaccctggggctggccctcttcactctgtgcggcaagttcaagaggtggaagctgaacggggccttcctcctcatcacagccttcctctctgtgctcatctgggtggcctggatgaccatgtacctcttcggcaatgtcaagctgcagcagggggatgcctggaacgaccccaccttggccatcacgctggcggccagcggctgggtcttcgtcatcttccacgccatccctgagatccactgcacccttctgccagccctgcaggagaacacgcccaactacttcgacacgtcgcagcccaggatgcgggagacggccttcgaggaggacgtgcagctgccgcgggcctatatggagaacaaggccttctccatggatgaacacaatgcagctctccgaacagcaggatttcccaacggcagcttgggaaaaagacccagtggcagcttggggaaaagacccagcgctccgtttagaagcaacgtgtatcagccaactgagatggccgtcgtgctcaacggtgggaccatcccaactgctccgccaagtcacacaggaagacacctttggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif, single stranded interacting protein 2 - immunoglobulin superfamily containing leucine-rich repeat - G protein-coupled receptor, family C, group 5, member C - StAR-related lipid transfer (START) domain containing 3 |