GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene View larger

GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034467
Product type: DNA & cDNA
Ncbi symbol: GPRC5B
Origin species: Human
Product name: GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene
Size: 2ug
Accessions: BC034467
Gene id: 51704
Gene description: G protein-coupled receptor, family C, group 5, member B
Synonyms: RAIG-2; RAIG2; G-protein coupled receptor family C group 5 member B; G protein-coupled receptor, family C, group 1, member B; retinoic acid responsive gene protein; retinoic acid-induced gene 2 protein; G protein-coupled receptor class C group 5 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgtggcatcagagagaaagatgagagctcaccaggtgctcaccttcctcctgctcttcgtgatcacctcggtggcctctgaaaacgccagcacatcccgaggctgtgggctggacctcctccctcagtacgtgtccctgtgcgacctggacgccatctggggcattgtggtggaggcggtggccggggcgggcgccctgatcacactgctcctgatgctcatcctcctggtgcggctgcccttcatcaaggagaaggagaagaagagccctgtgggcctccactttctgttcctcctggggaccctgggcctctttgggctgacgtttgccttcatcatccaggaggacgagaccatctgctctgtccgccgcttcctctggggcgtcctctttgcgctctgcttctcctgcctgctgagccaggcatggcgcgtgcggaggctggtgcggcatggcacgggccccgcgggctggcagctggtgggcctggcgctgtgcctgatgctggtgcaagtcatcatcgctgtggagtggctggtgctcaccgtgctgcgtgacacaaggccagcctgcgcctacgagcccatggactttgtgatggccctcatctacgacatggtactgcttgtggtcaccctggggctggccctcttcactctgtgcggcaagttcaagaggtggaagctgaacggggccttcctcctcatcacagccttcctctctgtgctcatctgggtggcctggatgaccatgtacctcttcggcaatgtcaagctgcagcagggggatgcctggaacgaccccaccttggccatcacgctggcggccagcggctgggtcttcgtcatcttccacgccatccctgagatccactgcacccttctgccagccctgcaggagaacacgcccaactacttcgacacgtcgcagcccaggatgcgggagacggccttcgaggaggacgtgcagctgccgcgggcctatatggagaacaaggccttctccatggatgaacacaatgcagctctccgaacagcaggatttcccaacggcagcttgggaaaaagacccagtggcagcttggggaaaagacccagcgctccgtttagaagcaacgtgtatcagccaactgagatggccgtcgtgctcaacggtgggaccatcccaactgctccgccaagtcacacaggaagacacctttggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif, single stranded interacting protein 2
- immunoglobulin superfamily containing leucine-rich repeat
- G protein-coupled receptor, family C, group 5, member C
- StAR-related lipid transfer (START) domain containing 3

Buy GPRC5B-G protein-coupled receptor, family C, group 5, member B Gene now

Add to cart