PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene View larger

PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000910
Product type: DNA & cDNA
Ncbi symbol: PPP1R7
Origin species: Human
Product name: PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene
Size: 2ug
Accessions: BC000910
Gene id: 5510
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 7
Synonyms: SDS22; protein phosphatase 1 regulatory subunit 7; protein phosphatase 1 regulatory subunit 22; protein phosphatase 1, regulatory (inhibitor) subunit 7; testis secretory sperm-binding protein Li 210a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggaacgcggcgcggggcagcaacagtcgcaggagatgatggaggttgacaggcgggtcgagtctgaagaatccggcgatgaagaagggaagaaacacagcagtggcatcgtggccgacctcagtgaacagagcctgaaggatggggaggagcggggggaggaggacccagaagaagaacatgagctgcctgtggacatggaaaccatcaacctggacagagatgcagaggatgttgatttgaatcactatcgcatagggaagattgaaggatttgaggtactgaagaaagtgaagactctctgcctccgccaaaatttaattaaatgcattgagaatctggaggagctacagagtcttcgagagctggatctttacgacaaccagatcaagaagattgagaatctggaggcgctaacagagctggagattctagatatttcttttaatctgctgagaaacatcgaaggggttgacaagttgacacgactgaaaaaactcttcttggtcaacaataaaatcagtaaaattgagaacttaagcaacttacatcaactacagatgctagagctgggatctaaccgcatccgggcaatcgaaaatatcgacaccttaaccaacctggagagtttgtttttggggaaaaacaaaattactaaacttcagaacctggatgcgctcaccaacctgacagtcctcagtatgcagagcaaccggctgaccaagatcgagggtctgcagaacctggtgaacctgcgggagctgtaccttagccacaatggcatcgaggtcatcgagggcctggagaacaataacaaactcacgatgttggacattgcatcaaatagaatcaaaaagattgaaaatatcagccatctaacagagctgcaagagttctggatgaacgacaatctccttgagagctggagcgacctcgacgagctgaagggagccaggagcctggagacagtgtacctggagcggaaccccttgcagaaggacccccagtaccggcggaaggtcatgctcgccctcccctccgtgcggcagatcgatgccacgttcgtcaggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GA binding protein transcription factor, beta subunit 1
- guanine nucleotide binding protein (G protein), alpha 13
- KIN, antigenic determinant of recA protein homolog (mouse)
- G protein-coupled receptor, family C, group 5, member B

Buy PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene now

Add to cart