Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene
PTXBC000910
New product
Data sheet of PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000910 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R7 |
| Origin species: | Human |
| Product name: | PPP1R7-protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene |
| Size: | 2ug |
| Accessions: | BC000910 |
| Gene id: | 5510 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 7 |
| Synonyms: | SDS22; protein phosphatase 1 regulatory subunit 7; protein phosphatase 1 regulatory subunit 22; protein phosphatase 1, regulatory (inhibitor) subunit 7; testis secretory sperm-binding protein Li 210a |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggaacgcggcgcggggcagcaacagtcgcaggagatgatggaggttgacaggcgggtcgagtctgaagaatccggcgatgaagaagggaagaaacacagcagtggcatcgtggccgacctcagtgaacagagcctgaaggatggggaggagcggggggaggaggacccagaagaagaacatgagctgcctgtggacatggaaaccatcaacctggacagagatgcagaggatgttgatttgaatcactatcgcatagggaagattgaaggatttgaggtactgaagaaagtgaagactctctgcctccgccaaaatttaattaaatgcattgagaatctggaggagctacagagtcttcgagagctggatctttacgacaaccagatcaagaagattgagaatctggaggcgctaacagagctggagattctagatatttcttttaatctgctgagaaacatcgaaggggttgacaagttgacacgactgaaaaaactcttcttggtcaacaataaaatcagtaaaattgagaacttaagcaacttacatcaactacagatgctagagctgggatctaaccgcatccgggcaatcgaaaatatcgacaccttaaccaacctggagagtttgtttttggggaaaaacaaaattactaaacttcagaacctggatgcgctcaccaacctgacagtcctcagtatgcagagcaaccggctgaccaagatcgagggtctgcagaacctggtgaacctgcgggagctgtaccttagccacaatggcatcgaggtcatcgagggcctggagaacaataacaaactcacgatgttggacattgcatcaaatagaatcaaaaagattgaaaatatcagccatctaacagagctgcaagagttctggatgaacgacaatctccttgagagctggagcgacctcgacgagctgaagggagccaggagcctggagacagtgtacctggagcggaaccccttgcagaaggacccccagtaccggcggaaggtcatgctcgccctcccctccgtgcggcagatcgatgccacgttcgtcaggttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GA binding protein transcription factor, beta subunit 1 - guanine nucleotide binding protein (G protein), alpha 13 - KIN, antigenic determinant of recA protein homolog (mouse) - G protein-coupled receptor, family C, group 5, member B |