PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene View larger

PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

PTXBC001888

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001888
Product type: DNA & cDNA
Ncbi symbol: PPP1CA
Origin species: Human
Product name: PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene
Size: 2ug
Accessions: BC001888
Gene id: 5499
Gene description: protein phosphatase 1, catalytic subunit, alpha isoform
Synonyms: PP-1A; PP1A; PP1alpha; PPP1A; serine/threonine-protein phosphatase PP1-alpha catalytic subunit; protein phosphatase 1, catalytic subunit, alpha isoform; protein phosphatase 1, catalytic subunit, alpha isozyme; serine/threonine protein phosphatase PP1-alpha 1 catalytic subunit; testicular tissue protein Li 155; protein phosphatase 1 catalytic subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgacagcgagaagctcaacctggactcgatcatcgggcgcctgctggaagtgcagggctcgcggcctggcaagaatgtacagctgacagagaacgagatccgcggtctgtgcctgaaatcccgggagatttttctgagccagcccattcttctggagctggaggcacccctcaagatctgcggtgacatacacggccagtactacgaccttctgcgactatttgagtatggcggtttccctcccgagagcaactacctctttctgggggactatgtggacaggggcaagcagtccttggagaccatctgcctgctgctggcctataagatcaagtaccccgagaacttcttcctgctccgtgggaaccacgagtgtgccagcatcaaccgcatctatggtttctacgatgagtgcaagagacgctacaacatcaaactgtggaaaaccttcactgactgcttcaactgcctgcccatcgcggccatagtggacgaaaagatcttctgctgccacggaggcctgtccccggacctgcagtctatggagcagattcggcggatcatgcggcccacagatgtgcctgaccagggcctgctgtgtgacctgctgtggtctgaccctgacaaggacgtgcagggctggggcgagaacgaccgtggcgtctcttttacctttggagccgaggtggtggccaagttcctccacaagcacgacttggacctcatctgccgagcacaccaggtggtagaagacggctacgagttctttgccaagcggcagctggtgacacttttctcagctcccaactactgtggcgagtttgacaatgctggcgccatgatgagtgtggacgagaccctcatgtgctctttccagatcctcaagcccgccgacaagaacaaggggaagtacgggcagttcagtggcctgaaccctggaggccgacccatcaccccaccccgcaattccgccaaagccaagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA (guanine-9-) methyltransferase domain containing 2
- synapse associated protein 1, SAP47 homolog (Drosophila)
- protein phosphatase 1, regulatory (inhibitor) subunit 7
- GA binding protein transcription factor, beta subunit 1

Buy PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene now

Add to cart