Login to display prices
Login to display prices
PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene View larger

PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

PTXBC001888

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene

Proteogenix catalog: PTXBC001888
Ncbi symbol: PPP1CA
Product name: PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene
Size: 2ug
Accessions: BC001888
Gene id: 5499
Gene description: protein phosphatase 1, catalytic subunit, alpha isoform
Synonyms: PP-1A; PP1A; PP1alpha; PPP1A; serine/threonine-protein phosphatase PP1-alpha catalytic subunit; protein phosphatase 1, catalytic subunit, alpha isoform; protein phosphatase 1, catalytic subunit, alpha isozyme; serine/threonine protein phosphatase PP1-alpha 1 catalytic subunit; testicular tissue protein Li 155; protein phosphatase 1 catalytic subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgacagcgagaagctcaacctggactcgatcatcgggcgcctgctggaagtgcagggctcgcggcctggcaagaatgtacagctgacagagaacgagatccgcggtctgtgcctgaaatcccgggagatttttctgagccagcccattcttctggagctggaggcacccctcaagatctgcggtgacatacacggccagtactacgaccttctgcgactatttgagtatggcggtttccctcccgagagcaactacctctttctgggggactatgtggacaggggcaagcagtccttggagaccatctgcctgctgctggcctataagatcaagtaccccgagaacttcttcctgctccgtgggaaccacgagtgtgccagcatcaaccgcatctatggtttctacgatgagtgcaagagacgctacaacatcaaactgtggaaaaccttcactgactgcttcaactgcctgcccatcgcggccatagtggacgaaaagatcttctgctgccacggaggcctgtccccggacctgcagtctatggagcagattcggcggatcatgcggcccacagatgtgcctgaccagggcctgctgtgtgacctgctgtggtctgaccctgacaaggacgtgcagggctggggcgagaacgaccgtggcgtctcttttacctttggagccgaggtggtggccaagttcctccacaagcacgacttggacctcatctgccgagcacaccaggtggtagaagacggctacgagttctttgccaagcggcagctggtgacacttttctcagctcccaactactgtggcgagtttgacaatgctggcgccatgatgagtgtggacgagaccctcatgtgctctttccagatcctcaagcccgccgacaagaacaaggggaagtacgggcagttcagtggcctgaaccctggaggccgacccatcaccccaccccgcaattccgccaaagccaagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: