MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene View larger

MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007298
Product type: DNA & cDNA
Ncbi symbol: MMS19
Origin species: Human
Product name: MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007298
Gene id: 64210
Gene description: MMS19 nucleotide excision repair homolog (S. cerevisiae)
Synonyms: MMS19 homolog, cytosolic iron-sulfur assembly component; homolog of yeast MMS19; MMS19-like protein; MMS19-like (MET18 homolog, S. cerevisiae); MMS19 nucleotide excision repair homolog; MMS19 cytosolic iron-sulfur assembly component; MMS19 nucleotide excision repair protein homolog; MET18; MMS19L; hMMS19; MET18 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggagcttttggaactgagctgctgccacagctgccccttttcttccaccgctgctgccaagtgctttgcaggactcctcaacaagcaccctgcagggcagcagctggatgaattcctacagctagctgtggacaaagtggaggctggcctgggctctgggccctgtcgtagtcaggccttcactcttcttctctgggtaacaaaggccctagtgctcagataccatcctctcagctcctgccttacagcccggctcatgggcctcctgagtgacccagaattaggtccagcagcagctgatggcttctctctgctcatgtctgactgcactgatgtgctgactcgtgctggccatgctgaagtgcggatcatgttccgccagcggttcttcacagataatgtgcctgctttggtccagggcttccatgctgctccccaagatgtgaagccaaactacttgaagggtctttctcatgtacttaacaggctgcccaagcctgtactcttgccagagctgcccacgcttctttccttgctgctggaggccctgtcctgccctgactgtgtggtgcagctctccaccctcagctgccttcagcctcttctactggaagcaccccaagtcatgagtcttcacgtggacaccctcgtcaccaagtttctgaacctcagctctagcccttccatggctgtccggatcgccgcactgcagtgcatgcatgctctcactcgcctgcccacccctgtgctgctgccgtacaaaccacaggtgattcgggccttagccaaacccctggatgacaagaagagactggtgcgcaaggaagcagtgtcagccagaggggagtggtttctgttggggagccctggcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - StAR-related lipid transfer (START) domain containing 7
- capping protein (actin filament) muscle Z-line, alpha 3
- Fc fragment of IgE, low affinity II, receptor for (CD23)
- protein phosphatase 1, catalytic subunit, alpha isoform

Buy MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene now

Add to cart