PTXBC007298
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007298 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MMS19 |
| Origin species: | Human |
| Product name: | MMS19-MMS19 nucleotide excision repair homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC007298 |
| Gene id: | 64210 |
| Gene description: | MMS19 nucleotide excision repair homolog (S. cerevisiae) |
| Synonyms: | MMS19 homolog, cytosolic iron-sulfur assembly component; homolog of yeast MMS19; MMS19-like protein; MMS19-like (MET18 homolog, S. cerevisiae); MMS19 nucleotide excision repair homolog; MMS19 cytosolic iron-sulfur assembly component; MMS19 nucleotide excision repair protein homolog; MET18; MMS19L; hMMS19; MET18 homolog |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggagcttttggaactgagctgctgccacagctgccccttttcttccaccgctgctgccaagtgctttgcaggactcctcaacaagcaccctgcagggcagcagctggatgaattcctacagctagctgtggacaaagtggaggctggcctgggctctgggccctgtcgtagtcaggccttcactcttcttctctgggtaacaaaggccctagtgctcagataccatcctctcagctcctgccttacagcccggctcatgggcctcctgagtgacccagaattaggtccagcagcagctgatggcttctctctgctcatgtctgactgcactgatgtgctgactcgtgctggccatgctgaagtgcggatcatgttccgccagcggttcttcacagataatgtgcctgctttggtccagggcttccatgctgctccccaagatgtgaagccaaactacttgaagggtctttctcatgtacttaacaggctgcccaagcctgtactcttgccagagctgcccacgcttctttccttgctgctggaggccctgtcctgccctgactgtgtggtgcagctctccaccctcagctgccttcagcctcttctactggaagcaccccaagtcatgagtcttcacgtggacaccctcgtcaccaagtttctgaacctcagctctagcccttccatggctgtccggatcgccgcactgcagtgcatgcatgctctcactcgcctgcccacccctgtgctgctgccgtacaaaccacaggtgattcgggccttagccaaacccctggatgacaagaagagactggtgcgcaaggaagcagtgtcagccagaggggagtggtttctgttggggagccctggcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - StAR-related lipid transfer (START) domain containing 7 - capping protein (actin filament) muscle Z-line, alpha 3 - Fc fragment of IgE, low affinity II, receptor for (CD23) - protein phosphatase 1, catalytic subunit, alpha isoform |