Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA13-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene
PTXBC009189
New product
Data sheet of NDUFA13-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA13-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009189 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA13 |
| Origin species: | Human |
| Product name: | NDUFA13-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene |
| Size: | 2ug |
| Accessions: | BC009189 |
| Gene id: | 51079 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 |
| Synonyms: | B16.6; CDA016; CGI-39; GRIM-19; GRIM19; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 13; CI-B16.6; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13; NADH-ubiquinone oxidoreductase B16.6 subunit; cell death regulatory protein GRIM-19; cell death-regulatory protein GRIM19; complex I B16.6 subunit; complex I-B16.6; gene associated with retinoic and IFN-induced mortality 19 protein; gene associated with retinoic and interferon-induced mortality 19 protein; NADH:ubiquinone oxidoreductase subunit A13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgtcaaaggtgaagcaggacatgcctccgccggggggctatgggcccatcgactacaaacggaacttgccgcgtcgaggactgtcgggctacagcatgctggccatagggattggaaccctgatctacgggcactggagcataatgaagtggaaccgtgagcgcaggcgcctacaaatcgaggacttcgaggctcgcatcgcgctgttgccactgttacaggcagaaaccgaccggaggaccttgcagatgcttcgggagaacctggaggaggaggccatcatcatgaaggacgtgcccgactggaaggtgggggagtctgtgttccacacaacccgctgggtgccccccttgatcggggagctgtacgggctgcgcaccacagaggaggctctccatgccagccacggcttcatgtggtacacgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - transmembrane emp24-like trafficking protein 10 (yeast) - coiled-coil-helix-coiled-coil-helix domain containing 3 |