Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene
PTXBC004498
New product
Data sheet of CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004498 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHCHD5 |
| Origin species: | Human |
| Product name: | CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene |
| Size: | 2ug |
| Accessions: | BC004498 |
| Gene id: | 84269 |
| Gene description: | coiled-coil-helix-coiled-coil-helix domain containing 5 |
| Synonyms: | C2orf9; MIC14; coiled-coil-helix-coiled-coil-helix domain-containing protein 5; mitochondrial intermembrane space cysteine motif protein of 14 kDa homolog; coiled-coil-helix-coiled-coil-helix domain containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggcggccctagaggtcaccgctcgctactgtggccgggagctggagcagtatggccagtgtgtggcggccaagccggaatcctggcagcgggactgtcactaccttaagatgagcattgcccagtgcacatcctcccacccaatcatccgccagatccgccaggcctgtgctcagccttttgaggccttcgaggagtgtcttcgacagaacgaggcagctgtgggcaactgtgcagagcatatgcgccgcttcctgcagtgcgctgagcaggtgcagccgccacgctcacctgcaactgtggaggcacagccacttcctgcctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 1 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |