Login to display prices
Login to display prices
CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene View larger

CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene

PTXBC004498

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene

Proteogenix catalog: PTXBC004498
Ncbi symbol: CHCHD5
Product name: CHCHD5-coiled-coil-helix-coiled-coil-helix domain containing 5 Gene
Size: 2ug
Accessions: BC004498
Gene id: 84269
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 5
Synonyms: C2orf9; MIC14; coiled-coil-helix-coiled-coil-helix domain-containing protein 5; mitochondrial intermembrane space cysteine motif protein of 14 kDa homolog; coiled-coil-helix-coiled-coil-helix domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcggccctagaggtcaccgctcgctactgtggccgggagctggagcagtatggccagtgtgtggcggccaagccggaatcctggcagcgggactgtcactaccttaagatgagcattgcccagtgcacatcctcccacccaatcatccgccagatccgccaggcctgtgctcagccttttgaggccttcgaggagtgtcttcgacagaacgaggcagctgtgggcaactgtgcagagcatatgcgccgcttcctgcagtgcgctgagcaggtgcagccgccacgctcacctgcaactgtggaggcacagccacttcctgcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: