CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene View larger

CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene

PTXBC010358

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010358
Product type: DNA & cDNA
Ncbi symbol: CYP39A1
Origin species: Human
Product name: CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene
Size: 2ug
Accessions: BC010358
Gene id: 51302
Gene description: cytochrome P450, family 39, subfamily A, polypeptide 1
Synonyms: 24-hydroxycholesterol 7-alpha-hydroxylase; cytochrome P450, family 39, subfamily A, polypeptide 1; cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1; cytochrome P450 family 39 subfamily A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaactaatttccccaacagtgattataatcctgggttgccttgctctgttcttactccttcagccgaagaatttgcgtagacccccgtgcatcaagggctggattccttggattggagttggatttgagtttgggaaagcccctctagaatttatagagaaagcaagaatcaagtatggaccaatatttacagtctttgctatgggaaaccgaatgacctttgttactgaagaagaaggaattaatgtgtttctaaaatccaaaaaagtagattttgaactagcagtgcaaaatatcgtttatcgtacagcatcaattccaaagaatgtctttttagcactgcatgaaaaactctatattatgttgaaagggaaaatggggactgtcaatctccatcagtttactgggcaactgactgaagaattacatgaacaactggagaatttaggcactcatgggacaatggacctgaacaacttagtaagacatctcctttatccagtcacagtgaatatgctctttaataaaagtttgttttccacaaacaagaaaaaaatcaaggagttccatcagtattttcaagtttatgatgaagattttgagtatgggtcccagttgccagagtgtcttctaagaaactggtcaaaatccaaaaagtggttcctggaactgtttgagaaaaacattccagatataaaagcatgtaaatctgcaaaagataattccatgacattattgcaagctacgctggatattgtagagacggaaacaagtaaggaaaactcacccaattatgggctcttactgctttgggcttctctgtctaatgctgttcctgttgcattttggacacttgcacacgtcctttctcatcctgatatccacaaggccattatggaaggcatatcttctgtgtttggcaaagcaggcaaagataagattaaagtgtctgaggatgacctggagaatctccttctaattaaatggtgtgttttggaaaccattcgtttaaaagctcctggtgtcattactagaaaagtggtgaagcctgtggaaattttgaattacatcattccttctggtgacttgttgatgttgtctccattttggctgcatagaaatccaaagtattttcctgagcctgaattgttcaaacctgaacgttggaaaaaggcaaatttagagaagcactctttcttggactgcttcatggcatttggaagcgggaagttccagtgtcctgcaaggtggtttgctctgttagaggttcagatgtgtattattttaatactttataaatatgactgtagtcttctggacccattacccaaacagagttatctccatttggtgggtgtcccccagccggaagggcaatgccgaattgaatataaacaaagaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae)
- guanine nucleotide binding protein (G protein), gamma 10
- coiled-coil-helix-coiled-coil-helix domain containing 5
- coiled-coil-helix-coiled-coil-helix domain containing 1

Buy CYP39A1-cytochrome P450, family 39, subfamily A, polypeptide 1 Gene now

Add to cart