Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene
PTXBC003665
New product
Data sheet of GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003665 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPRC5A |
| Origin species: | Human |
| Product name: | GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene |
| Size: | 2ug |
| Accessions: | BC003665 |
| Gene id: | 9052 |
| Gene description: | G protein-coupled receptor, family C, group 5, member A |
| Synonyms: | GPCR5A; PEIG-1; RAI3; RAIG1; TIG1; retinoic acid-induced protein 3; G-protein coupled receptor family C group 5 member A; TPA induced gene 1; orphan G-protein-coupling receptor PEIG-1; phorbol ester induced gene 1; phorbol ester induced protein-1; retinoic acid induced 3; retinoic acid responsive; retinoic acid-induced gene 1 protein; G protein-coupled receptor class C group 5 member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctacaacagtccctgatggttgccgcaatggcctgaaatccaagtactacagactttgtgataaggctgaagcttggggcatcgtcctagaaacggtggccacagctggggttgtgacctcggtggccttcatgctcactctcccgatcctcgtctgcaaggtgcaggactccaacaggcgaaaaatgctgcctactcagtttctcttcctcctgggtgtgttgggcatctttggcctcaccttcgccttcatcatcggactggacgggagcacagggcccacacgcttcttcctctttgggatcctcttttccatctgcttctcctgcctgctggctcatgctgtcagtctgaccaagctcgtccgggggaggaagcccctttccctgttggtgattctgggtctggccgtgggcttcagcctagtccaggatgttatcgctattgaatatattgtcctgaccatgaataggaccaacgtcaatgtcttttctgagctttccgctcctcgtcgcaatgaagactttgtcctcctgctcacctacgtcctcttcttgatggcgctgaccttcctcatgtcctccttcaccttctgtggttccttcacgggctggaagagacatggggcccacatctacctcacgatgctcctctccattgccatctgggtggcctggatcaccctgctcatgcttcctgactttgaccgcaggtgggatgacaccatcctcagctccgccttggctgccaatggctgggtgttcctgttggcttatgttagtcccgagttttggctgctcacaaagcaacgaaaccccatggattatcctgttgaggatgctttctgtaaacctcaactcgtgaagaagagctatggtgtggagaacagagcctactctcaagaggaaatcactcaaggttttgaagagacaggggacacgctctatgccccctattccacacattttcagctgcagaaccagcctccccaaaaggaattctccatcccacgggcccacgcttggccgagcccttacaaagactatgaagtaaagaaagagggcagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GA binding protein transcription factor, beta subunit 1 - transforming growth factor beta 1 induced transcript 1 - cytochrome P450, family 20, subfamily A, polypeptide 1 - cytochrome P450, family 39, subfamily A, polypeptide 1 |