GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene View larger

GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003665
Product type: DNA & cDNA
Ncbi symbol: GPRC5A
Origin species: Human
Product name: GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene
Size: 2ug
Accessions: BC003665
Gene id: 9052
Gene description: G protein-coupled receptor, family C, group 5, member A
Synonyms: GPCR5A; PEIG-1; RAI3; RAIG1; TIG1; retinoic acid-induced protein 3; G-protein coupled receptor family C group 5 member A; TPA induced gene 1; orphan G-protein-coupling receptor PEIG-1; phorbol ester induced gene 1; phorbol ester induced protein-1; retinoic acid induced 3; retinoic acid responsive; retinoic acid-induced gene 1 protein; G protein-coupled receptor class C group 5 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctacaacagtccctgatggttgccgcaatggcctgaaatccaagtactacagactttgtgataaggctgaagcttggggcatcgtcctagaaacggtggccacagctggggttgtgacctcggtggccttcatgctcactctcccgatcctcgtctgcaaggtgcaggactccaacaggcgaaaaatgctgcctactcagtttctcttcctcctgggtgtgttgggcatctttggcctcaccttcgccttcatcatcggactggacgggagcacagggcccacacgcttcttcctctttgggatcctcttttccatctgcttctcctgcctgctggctcatgctgtcagtctgaccaagctcgtccgggggaggaagcccctttccctgttggtgattctgggtctggccgtgggcttcagcctagtccaggatgttatcgctattgaatatattgtcctgaccatgaataggaccaacgtcaatgtcttttctgagctttccgctcctcgtcgcaatgaagactttgtcctcctgctcacctacgtcctcttcttgatggcgctgaccttcctcatgtcctccttcaccttctgtggttccttcacgggctggaagagacatggggcccacatctacctcacgatgctcctctccattgccatctgggtggcctggatcaccctgctcatgcttcctgactttgaccgcaggtgggatgacaccatcctcagctccgccttggctgccaatggctgggtgttcctgttggcttatgttagtcccgagttttggctgctcacaaagcaacgaaaccccatggattatcctgttgaggatgctttctgtaaacctcaactcgtgaagaagagctatggtgtggagaacagagcctactctcaagaggaaatcactcaaggttttgaagagacaggggacacgctctatgccccctattccacacattttcagctgcagaaccagcctccccaaaaggaattctccatcccacgggcccacgcttggccgagcccttacaaagactatgaagtaaagaaagagggcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GA binding protein transcription factor, beta subunit 1
- transforming growth factor beta 1 induced transcript 1
- cytochrome P450, family 20, subfamily A, polypeptide 1
- cytochrome P450, family 39, subfamily A, polypeptide 1

Buy GPRC5A-G protein-coupled receptor, family C, group 5, member A Gene now

Add to cart