ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene View larger

ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene

PTXBC001411

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001411
Product type: DNA & cDNA
Ncbi symbol: ATP6V1D
Origin species: Human
Product name: ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene
Size: 2ug
Accessions: BC001411
Gene id: 51382
Gene description: ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D
Synonyms: ATP6M; VATD; VMA8; V-type proton ATPase subunit D; ATPase, H+ transporting lysosomal, member M; ATPase, H+ transporting, lysosomal (vacuolar proton pump); ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D; H(+)-transporting two-sector ATPase, subunit M; V-ATPase 28 kDa accessory protein; V-ATPase D subunit; V-ATPase subunit D; vacuolar ATP synthase subunit D; vacuolar H-ATPase subunit D; vacuolar proton pump D subunit; vacuolar proton pump delta polypeptide; vacuolar proton pump subunit D; vacuolar proton-ATPase subunit D; ATPase H+ transporting V1 subunit D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggcaaagaccgaattgaaatctttccctcgcgaatggcacagaccatcatgaaggctcgtttaaagggagcacagacaggtcgaaacctcctgaagaaaaaatctgatgccttaactcttcgatttcgacagatcctaaagaagataatagagactaaaatgttgatgggcgaagtgatgagagaagctgccttttcactagctgaagccaagttcacagcaggtgacttcagcactacagttatccaaaatgtcaataaagcgcaagtgaagattcgagcgaagaaagataatgtagcaggtgttactttgccagtatttgaacattaccatgaaggaactgacagttatgaactgactggtttagccagaggtggggaacagttggctaaattaaagaggaattatgccaaagcagtggaactactggtggaactagcttctctgcagacttcttttgttactttggatgaagctattaagataaccaacaggcgtgtaaatgccattgaacatgtcatcattccccggattgaacgtactcttgcttatatcatcacagagctggatgagagagagcgagaagagttctataggttaaagaaaatacaagagaagaaaaagattctaaaggaaaaatctgagaaggacttggagcaaaggagagcagctggagaggtgttggagcctgctaatcttctggctgaagagaaggacgaggatcttctatttgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DR beta 1
- major histocompatibility complex, class II, DR beta 3
- protein phosphatase 1, catalytic subunit, gamma isoform
- G protein-coupled receptor, family C, group 5, member A

Buy ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene now

Add to cart