Login to display prices
Login to display prices
HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene View larger

HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene

PTXBC001023

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene

Proteogenix catalog: PTXBC001023
Ncbi symbol: HLA-DRB3
Product name: HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene
Size: 2ug
Accessions: BC001023
Gene id: 3125
Gene description: major histocompatibility complex, class II, DR beta 3
Synonyms: HLA-DR1B; HLA-DR3B; major histocompatibility complex, class II, DR beta 3; HLA class II histocompatibility antigen, DR beta 3 chain; MHC class II HLA-DR beta 3 chain; MHC class II antigen DR beta 3 chain; MHC class II antigen DRB3; human leucocyte antigen DRB3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgtctgaagctccctggaggctcctgcatggcagctctgacagtgacactgatggtgctgagctccccactggctttggctggggacacccaaccacgtttcctgtggcagggtaagtataagtgtcatttcttcaacgggacggagcgggtgcagttcctggaaagactcttctataaccaggaggagttcgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacggagctagggcggcctgtcgccgagtcctggaacagccagaaggacatcctggaggacaggcggggccaggtggacaccgtgtgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagtccatcctgaggtgactgtgtatcctgccaagactcagcccctgcagcaccacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtggttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatggagactggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaagtttacacctgccaagtggagcacccaagtgtgatgagccctctcacagtggaatggagagcacggtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggttgttcatctacttcaggaatcagaaaggacactctggacttcagccaacaggattcctgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: