HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene View larger

HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001023
Product type: DNA & cDNA
Ncbi symbol: HLA-DRB3
Origin species: Human
Product name: HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene
Size: 2ug
Accessions: BC001023
Gene id: 3125
Gene description: major histocompatibility complex, class II, DR beta 3
Synonyms: HLA-DR1B; HLA-DR3B; major histocompatibility complex, class II, DR beta 3; HLA class II histocompatibility antigen, DR beta 3 chain; MHC class II HLA-DR beta 3 chain; MHC class II antigen DR beta 3 chain; MHC class II antigen DRB3; human leucocyte antigen DRB3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgtctgaagctccctggaggctcctgcatggcagctctgacagtgacactgatggtgctgagctccccactggctttggctggggacacccaaccacgtttcctgtggcagggtaagtataagtgtcatttcttcaacgggacggagcgggtgcagttcctggaaagactcttctataaccaggaggagttcgtgcgcttcgacagcgacgtgggggagtaccgggcggtgacggagctagggcggcctgtcgccgagtcctggaacagccagaaggacatcctggaggacaggcggggccaggtggacaccgtgtgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagtccatcctgaggtgactgtgtatcctgccaagactcagcccctgcagcaccacaacctcctggtctgctctgtgagtggtttctatccaggcagcattgaagtcaggtggttccggaacggccaggaagagaaggctggggtggtgtccacaggcctgatccagaatggagactggaccttccagaccctggtgatgctggaaacagttcctcggagtggagaagtttacacctgccaagtggagcacccaagtgtgatgagccctctcacagtggaatggagagcacggtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggttgttcatctacttcaggaatcagaaaggacactctggacttcagccaacaggattcctgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, catalytic subunit, gamma isoform
- G protein-coupled receptor, family C, group 5, member A
- GA binding protein transcription factor, beta subunit 1
- transforming growth factor beta 1 induced transcript 1

Buy HLA-DRB3-major histocompatibility complex, class II, DR beta 3 Gene now

Add to cart