HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene View larger

HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012106
Product type: DNA & cDNA
Ncbi symbol: HLA-DQB1
Origin species: Human
Product name: HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene
Size: 2ug
Accessions: BC012106
Gene id: 3119
Gene description: major histocompatibility complex, class II, DQ beta 1
Synonyms: CELIAC1; HLA-DQB; IDDM1; HLA class II histocompatibility antigen, DQ beta 1 chain; MHC class II DQ beta chain; MHC class II HLA-DQ beta glycoprotein; MHC class II antigen DQB1; MHC class II antigen HLA-DQ-beta-1; major histocompatibility complex, class II, DQ beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttggaagaaggctttgcggatccctggaggccttcgggtagcaactgtgaccttgatgctggcgatgctgagcaccccggtggctgagggcagagactctcccgaggatttcgtgtaccagtttaagggcatgtgctacttcaccaacgggacggagcgcgtgcgtcttgtgaccagatacatctataaccgagaggagtacgcacgcttcgacagcgacgtgggggtgtatcgggcggtgacgccgctggggccgcctgccgccgagtactggaacagccagaaggaagtcctggagaggacccgggcggagttggacacggtgtgcagacacaactaccagttggagctccgcacgaccttgcagcggcgagtggagcccacagtgaccatctccccatccaggacagaggccctcaaccaccacaacctgctggtctgctcagtgacagatttctatccagcccagatcaaagtccggtggtttcggaatgaccaggaggagacaactggcgttgtgtccaccccccttattaggaacggtgactggaccttccagatcctggtgatgctggaaatgactccccagcgtggagacgtctacacctgccacgtggagcaccccagcctccagaaccccatcatcgtggagtggcgggctcagtctgaatctgcccagagcaagatgctgagtggcattggaggcttcgtgctggggctgatcttcctcgggctgggccttattatccatcacaggagtcagaaagggctcctgcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DR beta 1
- major histocompatibility complex, class II, DR beta 4
- polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
- cleft lip and palate associated transmembrane protein 1

Buy HLA-DQB1-major histocompatibility complex, class II, DQ beta 1 Gene now

Add to cart