Login to display prices
Login to display prices
HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene View larger

HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

PTXBC015000

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene

Proteogenix catalog: PTXBC015000
Ncbi symbol: HLA-DPB1
Product name: HLA-DPB1-major histocompatibility complex, class II, DP beta 1 Gene
Size: 2ug
Accessions: BC015000
Gene id: 3115
Gene description: major histocompatibility complex, class II, DP beta 1
Synonyms: HLA-DP; HLA-DP1B; HLA-DPB; HLA class II histocompatibility antigen, DP beta 1 chain; HLA class II histocompatibility antigen, DP(W4) beta chain; HLA-DP histocompatibility type, beta-1 subunit; MHC HLA DPB1; MHC class II HLA-DP-beta-1; MHC class II antigen DPB1; major histocompatibility complex, class II, DP beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttctgcaggtttctgcggccccccggacagtggctctgacggcgttactgatggtgctgctcacatctgtggtccagggcagggccactccagagaattacgtgcaccagttacggcaggaatgctacgcgtttaatgggacacagcgcttcctggagagatacatctacaaccgggaggagttcgtgcgcttcgacagcgacgtgggggagttccgggcggtgacggagctggggcggcctgatgaggactactggaacagccagaaggacatcctggaggaggagcgggcagtgccggacaggatgtgcagacacaactacgagctggacgaggccgtgaccctgcagcgccgagtccagcctagggtgaatgtttccccctccaagaaggggcccttgcagcaccacaacctgcttgtctgccacgtgacggatttctacccaggcagcattcaagtccgatggttcctgaatggacaggaggaaacagctggggtcgtgtccaccaacctgatccgtaatggagactggaccttccagatcctggtgatgctggaaatgaccccccagcagggagatgtctacacctgccaagtggagcacaccagcctggatagtcctgtcaccgtggagtggaaggcacagtctgattctgcccggagtaagacattgacgggagctgggggcttcgtgctggggctcatcatctgtggagtgggcatcttcatgcacaggaggagcaagaaagttcaacgaggatctgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: