THAP2-THAP domain containing, apoptosis associated protein 2 Gene View larger

THAP2-THAP domain containing, apoptosis associated protein 2 Gene

PTXBC008358

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP2-THAP domain containing, apoptosis associated protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about THAP2-THAP domain containing, apoptosis associated protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008358
Product type: DNA & cDNA
Ncbi symbol: THAP2
Origin species: Human
Product name: THAP2-THAP domain containing, apoptosis associated protein 2 Gene
Size: 2ug
Accessions: BC008358
Gene id: 83591
Gene description: THAP domain containing, apoptosis associated protein 2
Synonyms: THAP domain-containing protein 2; THAP domain containing, apoptosis associated protein 2; THAP domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaccaattgcgctgcggcgggctgtgccactacctacaacaagcacattaacatcagcttccacaggtttcctttggatcctaaaagaagaaaagaatgggttcgcctggttaggcgcaaaaattttgtgccaggaaaacacacttttctttgttcaaagcactttgaagcctcctgttttgacctaacaggacaaactcgacgacttaaaatggatgctgttccaaccatttttgatttttgtacccatataaagtctatgaaactcaagtcaaggaatcttttgaagaaaaacaacagttgttctccagctggaccatctaatttaaaatcaaacattagtagtcagcaagtactacttgaacacagctatgcctttaggaatcctatggaggcaaaaaagaggatcattaaactggaaaaagaaatagcaagcttaagaagaaaaatgaaaacttgcctacaaaaggaacgcagagcaactcgaagatggatcaaagccacgtgtttggtaaagaatttagaagcaaatagtgtattacctaaaggtacatcagaacacatgttaccaactgccttaagcagtcttcctttggaagattttaagatccttgaacaagatcaacaagataaaacactgctaagtctaaatctaaaacagaccaagagtaccttcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 3
- proteasome (prosome, macropain) subunit, alpha type, 4
- proteasome (prosome, macropain) subunit, alpha type, 1
- phosphatidylinositol transfer protein, cytoplasmic 1

Buy THAP2-THAP domain containing, apoptosis associated protein 2 Gene now

Add to cart