PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene View larger

PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005265
Product type: DNA & cDNA
Ncbi symbol: PSMA3
Origin species: Human
Product name: PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene
Size: 2ug
Accessions: BC005265
Gene id: 5684
Gene description: proteasome (prosome, macropain) subunit, alpha type, 3
Synonyms: HC8; PSC3; proteasome subunit alpha type-3; macropain subunit C8; multicatalytic endopeptidase complex subunit C8; proteasome (prosome, macropain) subunit, alpha type, 3; proteasome component C8; proteasome subunit C8; testicular secretory protein Li 43; proteasome subunit alpha 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcaatcggcactgggtatgacctgtcagcctctacattctctcctgacggaagagtttttcaagttgaatatgctatgaaggctgtggaaaatagtagtacagctattggaatcagatgcaaagatggtgttgtctttggggtagaaaaattagtcctttctaaactttatgaagaaggttccaacaaaagactttttaatgttgatcggcatgttggaatggcagtagcaggtttgttggcagatgctcgttctttagcagacatagcaagagaagaagcttccaacttcagatctaactttggctacaacattccactaaaacatcttgcagacagagtggccatgtatgtgcatgcatatacactctacagtgctgttagaccttttggctgcagtgtgaatgacggtgcgcaactctacatgattgacccatcaggtgtttcatacggttattggggctgtgccatcggcaaagccaggcaagctgcaaagacggaaatagagaagcttcagatgaaagaaatgacctgccgtgatatcgttaaagaagttgcaaaaataatttacatagtacatgacgaagttaaggataaagcttttgaactagaactcagctgggttggtgaattaactaatggaagacatgaaattgttccaaaagatataagagaagaagcagagaaatatgctaaggaatctctgaaggaagaagatgaatcagatgatgataatatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 4
- proteasome (prosome, macropain) subunit, alpha type, 1
- phosphatidylinositol transfer protein, cytoplasmic 1
- budding uninhibited by benzimidazoles 3 homolog (yeast)

Buy PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene now

Add to cart