Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene
PTXBC007905
New product
Data sheet of PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007905 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PITPNC1 |
| Origin species: | Human |
| Product name: | PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene |
| Size: | 2ug |
| Accessions: | BC007905 |
| Gene id: | 26207 |
| Gene description: | phosphatidylinositol transfer protein, cytoplasmic 1 |
| Synonyms: | M-RDGB-beta; MRDGBbeta; RDGB-BETA; RDGBB; RDGBB1; cytoplasmic phosphatidylinositol transfer protein 1; M-rdgB beta; mammalian rdgB homolog beta; retinal degeneration B beta 1; retinal degeneration B homolog beta; phosphatidylinositol transfer protein, cytoplasmic 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctgaaagagtaccggatctgcatgccgctcaccgtagacgagtacaaaattggacagctgtacatgatcagcaaacacagccatgaacagagtgaccggggagaaggggtggaggtcgtccagaatgagccctttgaggaccctcaccatggcaatgggcagttcaccgagaagcgggtgtatctcaacagcaaactgcctagttgggctagagctgttgtccccaaaatattttatgtgacagagaaggcttggaactattatccctacacaattacagaatacacatgttcctttctgccgaaattctccattcatatagaaaccaagtatgaggacaacaaaggaagcaatgacaccattttcgacaatgaagccaaagacgtggagagagaagtttgctttattgatattgcctgcgatgaaattccagagcgctactacaaagaatctgaggatcctaagcacttcaagtcagagaagacaggacggggacagttgagggaaggctggagagatagtcatcagcctatcatgtgctcctacaagctggtgactgtgaagtttgaggtctgggggcttcagaccagagtggaacaatttgtacacaaggtggtccgagacattctgctgattggacatagacaggcttttgcatgggttgatgagtggtatgatatgacaatggatgatgttcgggaatacgagaaaaacatgcatgaacaaaccaacataaaagtttgcaatcagcattcctcccctgtggatgacatagagagtcatgcccaaacaagtacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - budding uninhibited by benzimidazoles 3 homolog (yeast) - transcription factor Dp-2 (E2F dimerization partner 2) - nuclear factor I/C (CCAAT-binding transcription factor) - nucleolar complex associated 4 homolog (S. cerevisiae) |