PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene View larger

PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007905
Product type: DNA & cDNA
Ncbi symbol: PITPNC1
Origin species: Human
Product name: PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene
Size: 2ug
Accessions: BC007905
Gene id: 26207
Gene description: phosphatidylinositol transfer protein, cytoplasmic 1
Synonyms: M-RDGB-beta; MRDGBbeta; RDGB-BETA; RDGBB; RDGBB1; cytoplasmic phosphatidylinositol transfer protein 1; M-rdgB beta; mammalian rdgB homolog beta; retinal degeneration B beta 1; retinal degeneration B homolog beta; phosphatidylinositol transfer protein, cytoplasmic 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgaaagagtaccggatctgcatgccgctcaccgtagacgagtacaaaattggacagctgtacatgatcagcaaacacagccatgaacagagtgaccggggagaaggggtggaggtcgtccagaatgagccctttgaggaccctcaccatggcaatgggcagttcaccgagaagcgggtgtatctcaacagcaaactgcctagttgggctagagctgttgtccccaaaatattttatgtgacagagaaggcttggaactattatccctacacaattacagaatacacatgttcctttctgccgaaattctccattcatatagaaaccaagtatgaggacaacaaaggaagcaatgacaccattttcgacaatgaagccaaagacgtggagagagaagtttgctttattgatattgcctgcgatgaaattccagagcgctactacaaagaatctgaggatcctaagcacttcaagtcagagaagacaggacggggacagttgagggaaggctggagagatagtcatcagcctatcatgtgctcctacaagctggtgactgtgaagtttgaggtctgggggcttcagaccagagtggaacaatttgtacacaaggtggtccgagacattctgctgattggacatagacaggcttttgcatgggttgatgagtggtatgatatgacaatggatgatgttcgggaatacgagaaaaacatgcatgaacaaaccaacataaaagtttgcaatcagcattcctcccctgtggatgacatagagagtcatgcccaaacaagtacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - budding uninhibited by benzimidazoles 3 homolog (yeast)
- transcription factor Dp-2 (E2F dimerization partner 2)
- nuclear factor I/C (CCAAT-binding transcription factor)
- nucleolar complex associated 4 homolog (S. cerevisiae)

Buy PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene now

Add to cart