Login to display prices
Login to display prices
PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene View larger

PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene

PTXBC007905

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene

Proteogenix catalog: PTXBC007905
Ncbi symbol: PITPNC1
Product name: PITPNC1-phosphatidylinositol transfer protein, cytoplasmic 1 Gene
Size: 2ug
Accessions: BC007905
Gene id: 26207
Gene description: phosphatidylinositol transfer protein, cytoplasmic 1
Synonyms: M-RDGB-beta; MRDGBbeta; RDGB-BETA; RDGBB; RDGBB1; cytoplasmic phosphatidylinositol transfer protein 1; M-rdgB beta; mammalian rdgB homolog beta; retinal degeneration B beta 1; retinal degeneration B homolog beta; phosphatidylinositol transfer protein, cytoplasmic 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgaaagagtaccggatctgcatgccgctcaccgtagacgagtacaaaattggacagctgtacatgatcagcaaacacagccatgaacagagtgaccggggagaaggggtggaggtcgtccagaatgagccctttgaggaccctcaccatggcaatgggcagttcaccgagaagcgggtgtatctcaacagcaaactgcctagttgggctagagctgttgtccccaaaatattttatgtgacagagaaggcttggaactattatccctacacaattacagaatacacatgttcctttctgccgaaattctccattcatatagaaaccaagtatgaggacaacaaaggaagcaatgacaccattttcgacaatgaagccaaagacgtggagagagaagtttgctttattgatattgcctgcgatgaaattccagagcgctactacaaagaatctgaggatcctaagcacttcaagtcagagaagacaggacggggacagttgagggaaggctggagagatagtcatcagcctatcatgtgctcctacaagctggtgactgtgaagtttgaggtctgggggcttcagaccagagtggaacaatttgtacacaaggtggtccgagacattctgctgattggacatagacaggcttttgcatgggttgatgagtggtatgatatgacaatggatgatgttcgggaatacgagaaaaacatgcatgaacaaaccaacataaaagtttgcaatcagcattcctcccctgtggatgacatagagagtcatgcccaaacaagtacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: