Login to display prices
Login to display prices
NFIC-nuclear factor I/C (CCAAT-binding transcription factor) Gene View larger

NFIC-nuclear factor I/C (CCAAT-binding transcription factor) Gene

PTXBC012120

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFIC-nuclear factor I/C (CCAAT-binding transcription factor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFIC-nuclear factor I/C (CCAAT-binding transcription factor) Gene

Proteogenix catalog: PTXBC012120
Ncbi symbol: NFIC
Product name: NFIC-nuclear factor I/C (CCAAT-binding transcription factor) Gene
Size: 2ug
Accessions: BC012120
Gene id: 4782
Gene description: nuclear factor I/C (CCAAT-binding transcription factor)
Synonyms: CTF; CTF5; NF-I; NFI; nuclear factor 1 C-type; CCAAT-box-binding transcription factor; NF-I/C; NF1-C; TGGCA-binding protein; nuclear factor I/C (CCAAT-binding transcription factor); nuclear factor I C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtattcgtccccgctctgcctcacccaggatgagttccacccgttcatcgaggccctgctgcctcacgtccgcgccttcgcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcacgagaagcggatgtcgaaggacgaggagcgtgcggtcaaggacgagctgctgggcgagaagcccgaggtcaagcagaagtgggcgtcgcggctgctggccaagctgcgcaaggacatccggcccgagtgccgcgaggacttcgtgctgagcatcaccggcaagaaggcgccgggctgcgtgctctccaaccccgaccagaagggcaagatgcggcgcatcgactgtctccggcaggcggacaaggtgtggcggctggacctggtcatggtcatcctgttcaagggcatcccgctggagagcaccgacggcgagcgcctggtcaaggctgcgcagtgcggtcacccggtcctgtgcgtgcagccgcaccacattggcgtggccgtcaaggagctggacctctacctggcctacttcgtgcgtgagcgagatgcagagcaaagcggcagtccccggacagggatgggctctgaccaggaggacagcaagcccatcacgctggacacgaccgacttccaggagagctttgtcacctccggcgtgttcagcgtcactgagctcatccaagtgtcccggacacccgtggtgactggaacaggacccaacttctccctgggggagctgcaggggcacctggcatacgacctgaacccagccagcactggcctcagaagaacgctgcccagcacctcctccagtgggagcaagcggcacaaatcgggctcgatggaggaagacgtggacacgagccctggcggcgattactacacttcgcccagctcgcccacgagtagcagccgcaactggacggaggacatggaaggaggcatctcgtccccggtgaagaagacagagatggacaagtcaccattcaacagcccgtccccccaggactctccccgcctctccagcttcacccagcaccaccggcccgtcatcgccgtgcacagcgggatcgcccggagcccacacccgtcctccgctctgcatttccctacgacgtccatcctaccccagacggcctccacctacttcccccacacggccatccgctacccacctcatctcaacccccaggacccgctcaaagatcttgtctcgctggcctgcgacccagccagccagcaacctggaccgtcctggtatctgggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: