Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SUMO3-SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) Gene
PTXBC000036
New product
Data sheet of SUMO3-SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUMO3-SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000036 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO3 |
| Origin species: | Human |
| Product name: | SUMO3-SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000036 |
| Gene id: | 6612 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) |
| Synonyms: | SMT3A; SMT3H1; SUMO-3; Smt3B; small ubiquitin-related modifier 3; SMT3 suppressor of mif two 3 homolog 1; SMT3 suppressor of mif two 3 homolog 3; ubiquitin-like protein SMT3B; small ubiquitin-like modifier 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgaggagaagcccaaggagggtgtgaagacagagaatgaccacatcaacctgaaggtggccgggcaggacggctccgtggtgcagttcaagatcaagaggcacacgccgctgagcaagctgatgaaggcctactgcgagaggcagggcttgtcaatgaggcagatcagattcaggttcgacgggcagccaatcaatgaaactgacactccagcacagctggagatggaggacgaggacaccatcgacgtgttccagcagcagacgggaggtgtgccggagagcagcctggcagggcacagtttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa - recombination activating gene 1 activating protein 1 - tRNA splicing endonuclease 15 homolog (S. cerevisiae) - NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa |