PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene View larger

PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005932
Product type: DNA & cDNA
Ncbi symbol: PSMA1
Origin species: Human
Product name: PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene
Size: 2ug
Accessions: BC005932
Gene id: 5682
Gene description: proteasome (prosome, macropain) subunit, alpha type, 1
Synonyms: HC2; HEL-S-275; PROS30; proteasome subunit alpha type-1; 30 kDa prosomal protein; PROS-30; epididymis secretory protein Li 275; macropain subunit C2; macropain subunit nu; multicatalytic endopeptidase complex subunit C2; proteasome (prosome, macropain) subunit, alpha type, 1; proteasome component C2; proteasome nu chain; proteasome subunit nu; proteasome subunit, alpha-type, 1; protein P30-33K; testicular tissue protein Li 150; proteasome subunit alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcgaaatcagtatgacaatgatgtcactgtttggagcccccagggcaggattcatcaaattgaatatgcaatggaagctgttaaacaaggttcagccacagttgttctgaaatcaaaaactcatgcagttttggttgcattgaaaagggcgcaatcagagcttgcagctcatcagaaaaaaattctccatgttgacaaccatattggtatctcaattgcggggcttactgctgatgctagactgttatgtaattttatgcgtcaggagtgtttggattccagatttgtattcgatagaccactgcctgtgtctcgtcttgtatctctaattggaagcaagacccagataccaacacaacgatatggccggagaccatatggtgttggtctccttattgctggttatgatgatatgggccctcacattttccaaacctgtccatctgctaactattttgactgcagagccatgtccattggagcccgttcccaatcagctcgtacttacttggagagacatatgtctgaatttatggagtgtaatttaaatgaactagttaaacatggtctgcgtgccttaagagagacgcttcctgcagaacaggacctgactacaaagaatgtttccattggaattgttggtaaagacttggagtttacaatctatgatgatgatgatgtgtctccattcctggaaggtcttgaagaaagaccacagagaaaggcacagcctgctcaacctgctgatgaacctgcagaaaaggctgatgaaccaatggaacattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol transfer protein, cytoplasmic 1
- budding uninhibited by benzimidazoles 3 homolog (yeast)
- transcription factor Dp-2 (E2F dimerization partner 2)
- nuclear factor I/C (CCAAT-binding transcription factor)

Buy PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene now

Add to cart