PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene View larger

PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005361
Product type: DNA & cDNA
Ncbi symbol: PSMA4
Origin species: Human
Product name: PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene
Size: 2ug
Accessions: BC005361
Gene id: 5685
Gene description: proteasome (prosome, macropain) subunit, alpha type, 4
Synonyms: HC9; HsT17706; PSC9; proteasome subunit alpha type-4; macropain subunit C9; multicatalytic endopeptidase complex subunit C9; proteasome (prosome, macropain) subunit, alpha type, 4; proteasome component C9; proteasome subunit HC9; proteasome subunit L; proteasome subunit alpha 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcgaagatatgactccaggaccactatattttctccagaaggtcgcttataccaagttgaatatgccatggaagctattggacatgcaggcacctgtttgggaattttagcaaatgatggtgttttgcttgcagcagagagacgcaacatccacaagcttcttgatgaagtctttttttctgaaaaaatttataaactcaatgaggacatggcttgcagtgtggcaggcataacttctgatgctaatgttctgactaatgaactaaggctcattgctcaaaggtatttattacagtatcaggagccaataccttgtgagcagttggttacagcgctgtgtgatatcaaacaagcttatacacaatttggaggaaaacgtccctttggtgtttcattgctgtacattggctgggataagcactatggctttcagctctatcagagtgaccctagtggaaattacgggggatggaaggccacatgcattggaaataatagcgctgcagctgtgtcaatgttgaaacaagactataaagaaggagaaatgaccttgaagtcagcacttgctttagctatcaaagtactaaataagaccatggatgttagtaaactctctgctgaaaaagtggaaattgcaacactaacaagagagaatggaaagacagtaatcagagttctcaaacaaaaagaagtggagcagttgatcaaaaaacacgaggaagaagaagccaaagctgagcgtgagaagaaagaaaaagaacagaaagaaaaggataaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 1
- phosphatidylinositol transfer protein, cytoplasmic 1
- budding uninhibited by benzimidazoles 3 homolog (yeast)
- transcription factor Dp-2 (E2F dimerization partner 2)

Buy PSMA4-proteasome (prosome, macropain) subunit, alpha type, 4 Gene now

Add to cart